Incidental Mutation 'R7348:Vcl'
ID570381
Institutional Source Beutler Lab
Gene Symbol Vcl
Ensembl Gene ENSMUSG00000021823
Gene Namevinculin
Synonymsmetavinculin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7348 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20929398-21033676 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21008952 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 545 (C545*)
Ref Sequence ENSEMBL: ENSMUSP00000022369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022369]
Predicted Effect probably null
Transcript: ENSMUST00000022369
AA Change: C545*
SMART Domains Protein: ENSMUSP00000022369
Gene: ENSMUSG00000021823
AA Change: C545*

DomainStartEndE-ValueType
Pfam:Vinculin 3 485 9e-203 PFAM
Pfam:Vinculin 475 1066 1.7e-301 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vinculin is a cytoskeletal protein associated with cell-cell and cell-matrix junctions, where it is thought to function as one of several interacting proteins involved in anchoring F-actin to the membrane. Defects in VCL are the cause of cardiomyopathy dilated type 1W. Dilated cardiomyopathy is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 10 with failed midline fusion of the rostral neural tube, bilobular cranial development and compromised cranial and spinal nerve development. Abnormal myocardial and endocardial structures are seen in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,866,159 R282C probably damaging Het
Adcy2 T A 13: 68,734,675 E314D possibly damaging Het
Adgrl2 A T 3: 148,817,766 I274N Het
Adpgk A G 9: 59,313,786 I292V probably benign Het
Agtrap G T 4: 148,080,597 F124L probably benign Het
Ankrd26 A G 6: 118,508,564 Y1450H probably damaging Het
Ap4e1 A T 2: 127,061,976 S933C probably damaging Het
Ap4e1 G T 2: 127,061,977 S933I possibly damaging Het
Ap5s1 A T 2: 131,212,652 T128S possibly damaging Het
Arih1 T C 9: 59,486,058 Y97C probably damaging Het
Atp1a3 A G 7: 24,978,826 F1034S unknown Het
Bmp6 T C 13: 38,485,903 S388P probably benign Het
Ccdc39 A G 3: 33,832,676 V261A possibly damaging Het
Ccdc66 C T 14: 27,500,336 C150Y probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cln6 A G 9: 62,849,176 S201G probably benign Het
Cntnap4 T C 8: 112,665,277 Y125H probably damaging Het
Copa A G 1: 172,102,223 T286A possibly damaging Het
Cul9 A T 17: 46,510,993 I1852K possibly damaging Het
Cyp2j8 C A 4: 96,444,640 A490S probably benign Het
Cyp2t4 A G 7: 27,157,251 I239V probably benign Het
E2f7 C T 10: 110,780,975 T692I probably damaging Het
Fastkd5 A G 2: 130,615,135 Y512H probably damaging Het
Fastkd5 A C 2: 130,616,439 M77R probably benign Het
Fhod3 A G 18: 25,090,467 R957G possibly damaging Het
Gm17018 A G 19: 45,572,466 Y111C probably damaging Het
H6pd C A 4: 149,983,902 probably null Het
Haus5 G T 7: 30,656,966 P544Q possibly damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Igf2r A G 17: 12,703,484 Y1248H probably damaging Het
Izumo3 T C 4: 92,147,218 N6S possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Map3k8 T A 18: 4,340,561 H251L probably damaging Het
Mapre3 T C 5: 30,861,829 Y6H probably benign Het
Mlh3 G T 12: 85,267,441 P657Q probably damaging Het
Mrgpra1 T C 7: 47,335,409 Y174C probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh1 C A 11: 67,202,539 P152Q probably damaging Het
Myh6 A T 14: 54,952,259 L1110Q probably damaging Het
Nf1 T A 11: 79,536,850 S1778T probably benign Het
Nkpd1 G A 7: 19,524,416 E707K probably damaging Het
Nlrp4a A G 7: 26,444,273 E21G probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1354 A G 10: 78,917,562 T241A probably damaging Het
Olfr453 T C 6: 42,744,856 L273S possibly damaging Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr491 T C 7: 108,317,713 V273A possibly damaging Het
Parg G A 14: 32,250,079 R677Q possibly damaging Het
Pcsk5 A T 19: 17,456,818 C1395* probably null Het
Psd2 G A 18: 35,980,336 S287N possibly damaging Het
Psd3 T C 8: 67,790,931 N685S possibly damaging Het
Pygb C T 2: 150,786,983 T39M probably benign Het
Rbfox1 C A 16: 7,408,024 Y351* probably null Het
Rftn1 A G 17: 50,004,323 L396P probably damaging Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Scn5a T C 9: 119,535,833 M440V probably benign Het
Sel1l2 T C 2: 140,265,724 N240S probably benign Het
Skint1 T C 4: 112,021,573 L234P probably damaging Het
Skint11 T A 4: 114,244,722 Y311N probably benign Het
Slc6a5 A T 7: 49,910,167 probably benign Het
Tas2r134 T C 2: 51,628,402 S298P possibly damaging Het
Tbcd C A 11: 121,594,311 A773D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmem184a T C 5: 139,814,054 E24G probably null Het
Tmem207 C A 16: 26,516,827 W53C possibly damaging Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Ttc37 T C 13: 76,182,884 F1478L possibly damaging Het
Ttc41 G T 10: 86,750,348 E839* probably null Het
Ufd1 T G 16: 18,815,885 probably benign Het
Usp28 A G 9: 49,030,877 E713G probably benign Het
Utrn A G 10: 12,748,018 W159R probably damaging Het
Vmn1r120 A T 7: 21,053,452 S111R probably damaging Het
Wwox T A 8: 114,472,652 C146S probably benign Het
Zbtb2 T C 10: 4,374,574 T57A possibly damaging Het
Zfp362 T C 4: 128,777,217 D336G possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Zfp704 A G 3: 9,474,598 S231P probably damaging Het
Zhx3 G T 2: 160,782,118 S43* probably null Het
Other mutations in Vcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vcl APN 14 20987003 missense probably benign 0.00
IGL01755:Vcl APN 14 20995970 missense probably damaging 0.99
IGL01994:Vcl APN 14 21003243 missense probably damaging 1.00
IGL02128:Vcl APN 14 21020577 missense probably benign
IGL02168:Vcl APN 14 21007287 missense probably benign 0.21
IGL02502:Vcl APN 14 21019385 missense probably damaging 1.00
IGL02574:Vcl APN 14 20929575 nonsense probably null
IGL03103:Vcl APN 14 21024280 missense probably damaging 1.00
IGL03046:Vcl UTSW 14 21022017 missense possibly damaging 0.52
R0137:Vcl UTSW 14 20987015 nonsense probably null
R0320:Vcl UTSW 14 20985624 splice site probably benign
R1442:Vcl UTSW 14 20983378 missense probably damaging 1.00
R1546:Vcl UTSW 14 21008950 missense probably damaging 1.00
R1692:Vcl UTSW 14 21024182 missense probably damaging 0.99
R1709:Vcl UTSW 14 21019373 missense probably benign 0.03
R1737:Vcl UTSW 14 21020536 missense probably damaging 1.00
R1848:Vcl UTSW 14 21008995 missense probably benign 0.03
R1902:Vcl UTSW 14 20982699 missense probably damaging 1.00
R4623:Vcl UTSW 14 21014939 missense probably benign 0.33
R4654:Vcl UTSW 14 20985752 splice site probably null
R5084:Vcl UTSW 14 21008959 missense possibly damaging 0.54
R5168:Vcl UTSW 14 21010102 missense probably damaging 1.00
R5275:Vcl UTSW 14 21010078 missense probably damaging 1.00
R6637:Vcl UTSW 14 21003132 missense probably damaging 1.00
R6859:Vcl UTSW 14 20987075 missense probably damaging 1.00
R7348:Vcl UTSW 14 21003150 missense probably benign
R7532:Vcl UTSW 14 21029324 missense probably damaging 1.00
R7630:Vcl UTSW 14 20983402 nonsense probably null
R7650:Vcl UTSW 14 20995046 missense probably damaging 1.00
X0028:Vcl UTSW 14 20985662 nonsense probably null
X0060:Vcl UTSW 14 21020776 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCCCATACCCCTATTAAATGCTATCTA -3'
(R):5'- GCCTCAGGCCAAGATGGG -3'

Sequencing Primer
(F):5'- TTTAGGTCAGGCTGCCAT -3'
(R):5'- CAGTCAGTAAAGTGCTTGCC -3'
Posted On2019-09-13