Incidental Mutation 'R7348:Myh6'
ID570384
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7348 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54952259 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1110 (L1110Q)
Ref Sequence ENSEMBL: ENSMUSP00000080538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably damaging
Transcript: ENSMUST00000081857
AA Change: L1110Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: L1110Q

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226297
AA Change: L1110Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,866,159 R282C probably damaging Het
Adcy2 T A 13: 68,734,675 E314D possibly damaging Het
Adgrl2 A T 3: 148,817,766 I274N Het
Adpgk A G 9: 59,313,786 I292V probably benign Het
Agtrap G T 4: 148,080,597 F124L probably benign Het
Ankrd26 A G 6: 118,508,564 Y1450H probably damaging Het
Ap4e1 A T 2: 127,061,976 S933C probably damaging Het
Ap4e1 G T 2: 127,061,977 S933I possibly damaging Het
Ap5s1 A T 2: 131,212,652 T128S possibly damaging Het
Arih1 T C 9: 59,486,058 Y97C probably damaging Het
Atp1a3 A G 7: 24,978,826 F1034S unknown Het
Bmp6 T C 13: 38,485,903 S388P probably benign Het
Ccdc39 A G 3: 33,832,676 V261A possibly damaging Het
Ccdc66 C T 14: 27,500,336 C150Y probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cln6 A G 9: 62,849,176 S201G probably benign Het
Cntnap4 T C 8: 112,665,277 Y125H probably damaging Het
Copa A G 1: 172,102,223 T286A possibly damaging Het
Cul9 A T 17: 46,510,993 I1852K possibly damaging Het
Cyp2j8 C A 4: 96,444,640 A490S probably benign Het
Cyp2t4 A G 7: 27,157,251 I239V probably benign Het
E2f7 C T 10: 110,780,975 T692I probably damaging Het
Fastkd5 A G 2: 130,615,135 Y512H probably damaging Het
Fastkd5 A C 2: 130,616,439 M77R probably benign Het
Fhod3 A G 18: 25,090,467 R957G possibly damaging Het
Gm17018 A G 19: 45,572,466 Y111C probably damaging Het
H6pd C A 4: 149,983,902 probably null Het
Haus5 G T 7: 30,656,966 P544Q possibly damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Igf2r A G 17: 12,703,484 Y1248H probably damaging Het
Izumo3 T C 4: 92,147,218 N6S possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Map3k8 T A 18: 4,340,561 H251L probably damaging Het
Mapre3 T C 5: 30,861,829 Y6H probably benign Het
Mlh3 G T 12: 85,267,441 P657Q probably damaging Het
Mrgpra1 T C 7: 47,335,409 Y174C probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh1 C A 11: 67,202,539 P152Q probably damaging Het
Nf1 T A 11: 79,536,850 S1778T probably benign Het
Nkpd1 G A 7: 19,524,416 E707K probably damaging Het
Nlrp4a A G 7: 26,444,273 E21G probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1354 A G 10: 78,917,562 T241A probably damaging Het
Olfr453 T C 6: 42,744,856 L273S possibly damaging Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr491 T C 7: 108,317,713 V273A possibly damaging Het
Parg G A 14: 32,250,079 R677Q possibly damaging Het
Pcsk5 A T 19: 17,456,818 C1395* probably null Het
Psd2 G A 18: 35,980,336 S287N possibly damaging Het
Psd3 T C 8: 67,790,931 N685S possibly damaging Het
Pygb C T 2: 150,786,983 T39M probably benign Het
Rbfox1 C A 16: 7,408,024 Y351* probably null Het
Rftn1 A G 17: 50,004,323 L396P probably damaging Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Scn5a T C 9: 119,535,833 M440V probably benign Het
Sel1l2 T C 2: 140,265,724 N240S probably benign Het
Skint1 T C 4: 112,021,573 L234P probably damaging Het
Skint11 T A 4: 114,244,722 Y311N probably benign Het
Slc6a5 A T 7: 49,910,167 probably benign Het
Tas2r134 T C 2: 51,628,402 S298P possibly damaging Het
Tbcd C A 11: 121,594,311 A773D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmem184a T C 5: 139,814,054 E24G probably null Het
Tmem207 C A 16: 26,516,827 W53C possibly damaging Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Ttc37 T C 13: 76,182,884 F1478L possibly damaging Het
Ttc41 G T 10: 86,750,348 E839* probably null Het
Ufd1 T G 16: 18,815,885 probably benign Het
Usp28 A G 9: 49,030,877 E713G probably benign Het
Utrn A G 10: 12,748,018 W159R probably damaging Het
Vcl C T 14: 21,003,150 A411V probably benign Het
Vcl T A 14: 21,008,952 C545* probably null Het
Vmn1r120 A T 7: 21,053,452 S111R probably damaging Het
Wwox T A 8: 114,472,652 C146S probably benign Het
Zbtb2 T C 10: 4,374,574 T57A possibly damaging Het
Zfp362 T C 4: 128,777,217 D336G possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Zfp704 A G 3: 9,474,598 S231P probably damaging Het
Zhx3 G T 2: 160,782,118 S43* probably null Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTCAATAACGGGAAAGC -3'
(R):5'- TTCCCTGGACACACTGAAAG -3'

Sequencing Primer
(F):5'- CTCAATAACGGGAAAGCTAGTGTTCC -3'
(R):5'- AACCCCTTTGCTGTCTGGG -3'
Posted On2019-09-13