Incidental Mutation 'R7348:Rftn1'
ID570390
Institutional Source Beutler Lab
Gene Symbol Rftn1
Ensembl Gene ENSMUSG00000039316
Gene Nameraftlin lipid raft linker 1
Synonyms2310015N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7348 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location49992257-50190674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50004323 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 396 (L396P)
Ref Sequence ENSEMBL: ENSMUSP00000046524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044503] [ENSMUST00000113195]
Predicted Effect probably damaging
Transcript: ENSMUST00000044503
AA Change: L396P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046524
Gene: ENSMUSG00000039316
AA Change: L396P

DomainStartEndE-ValueType
Pfam:Raftlin 1 473 1.3e-219 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113195
AA Change: L118P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108820
Gene: ENSMUSG00000039316
AA Change: L118P

DomainStartEndE-ValueType
Pfam:Raftlin 1 207 1.5e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations have defects in T cell activation, T cell help to B cells, and Th17 differentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,866,159 R282C probably damaging Het
Adcy2 T A 13: 68,734,675 E314D possibly damaging Het
Adgrl2 A T 3: 148,817,766 I274N Het
Adpgk A G 9: 59,313,786 I292V probably benign Het
Agtrap G T 4: 148,080,597 F124L probably benign Het
Ankrd26 A G 6: 118,508,564 Y1450H probably damaging Het
Ap4e1 A T 2: 127,061,976 S933C probably damaging Het
Ap4e1 G T 2: 127,061,977 S933I possibly damaging Het
Ap5s1 A T 2: 131,212,652 T128S possibly damaging Het
Arih1 T C 9: 59,486,058 Y97C probably damaging Het
Atp1a3 A G 7: 24,978,826 F1034S unknown Het
Bmp6 T C 13: 38,485,903 S388P probably benign Het
Ccdc39 A G 3: 33,832,676 V261A possibly damaging Het
Ccdc66 C T 14: 27,500,336 C150Y probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cln6 A G 9: 62,849,176 S201G probably benign Het
Cntnap4 T C 8: 112,665,277 Y125H probably damaging Het
Copa A G 1: 172,102,223 T286A possibly damaging Het
Cul9 A T 17: 46,510,993 I1852K possibly damaging Het
Cyp2j8 C A 4: 96,444,640 A490S probably benign Het
Cyp2t4 A G 7: 27,157,251 I239V probably benign Het
E2f7 C T 10: 110,780,975 T692I probably damaging Het
Fastkd5 A G 2: 130,615,135 Y512H probably damaging Het
Fastkd5 A C 2: 130,616,439 M77R probably benign Het
Fhod3 A G 18: 25,090,467 R957G possibly damaging Het
Gm17018 A G 19: 45,572,466 Y111C probably damaging Het
H6pd C A 4: 149,983,902 probably null Het
Haus5 G T 7: 30,656,966 P544Q possibly damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Igf2r A G 17: 12,703,484 Y1248H probably damaging Het
Izumo3 T C 4: 92,147,218 N6S possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Map3k8 T A 18: 4,340,561 H251L probably damaging Het
Mapre3 T C 5: 30,861,829 Y6H probably benign Het
Mlh3 G T 12: 85,267,441 P657Q probably damaging Het
Mrgpra1 T C 7: 47,335,409 Y174C probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh1 C A 11: 67,202,539 P152Q probably damaging Het
Myh6 A T 14: 54,952,259 L1110Q probably damaging Het
Nf1 T A 11: 79,536,850 S1778T probably benign Het
Nkpd1 G A 7: 19,524,416 E707K probably damaging Het
Nlrp4a A G 7: 26,444,273 E21G probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1354 A G 10: 78,917,562 T241A probably damaging Het
Olfr453 T C 6: 42,744,856 L273S possibly damaging Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr491 T C 7: 108,317,713 V273A possibly damaging Het
Parg G A 14: 32,250,079 R677Q possibly damaging Het
Pcsk5 A T 19: 17,456,818 C1395* probably null Het
Psd2 G A 18: 35,980,336 S287N possibly damaging Het
Psd3 T C 8: 67,790,931 N685S possibly damaging Het
Pygb C T 2: 150,786,983 T39M probably benign Het
Rbfox1 C A 16: 7,408,024 Y351* probably null Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Scn5a T C 9: 119,535,833 M440V probably benign Het
Sel1l2 T C 2: 140,265,724 N240S probably benign Het
Skint1 T C 4: 112,021,573 L234P probably damaging Het
Skint11 T A 4: 114,244,722 Y311N probably benign Het
Slc6a5 A T 7: 49,910,167 probably benign Het
Tas2r134 T C 2: 51,628,402 S298P possibly damaging Het
Tbcd C A 11: 121,594,311 A773D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmem184a T C 5: 139,814,054 E24G probably null Het
Tmem207 C A 16: 26,516,827 W53C possibly damaging Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Ttc37 T C 13: 76,182,884 F1478L possibly damaging Het
Ttc41 G T 10: 86,750,348 E839* probably null Het
Ufd1 T G 16: 18,815,885 probably benign Het
Usp28 A G 9: 49,030,877 E713G probably benign Het
Utrn A G 10: 12,748,018 W159R probably damaging Het
Vcl C T 14: 21,003,150 A411V probably benign Het
Vcl T A 14: 21,008,952 C545* probably null Het
Vmn1r120 A T 7: 21,053,452 S111R probably damaging Het
Wwox T A 8: 114,472,652 C146S probably benign Het
Zbtb2 T C 10: 4,374,574 T57A possibly damaging Het
Zfp362 T C 4: 128,777,217 D336G possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Zfp704 A G 3: 9,474,598 S231P probably damaging Het
Zhx3 G T 2: 160,782,118 S43* probably null Het
Other mutations in Rftn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Rftn1 APN 17 50055377 missense probably benign 0.01
IGL02318:Rftn1 APN 17 50036970 missense possibly damaging 0.95
IGL02568:Rftn1 APN 17 50036999 missense probably damaging 1.00
IGL02873:Rftn1 APN 17 50169152 utr 5 prime probably benign
IGL02965:Rftn1 APN 17 50055252 missense probably benign 0.32
R0544:Rftn1 UTSW 17 49994261 missense possibly damaging 0.71
R2219:Rftn1 UTSW 17 50169145 start codon destroyed probably null 1.00
R4542:Rftn1 UTSW 17 50055231 splice site probably null
R5318:Rftn1 UTSW 17 49994458 missense probably benign 0.09
R5605:Rftn1 UTSW 17 50047407 missense probably damaging 1.00
R5700:Rftn1 UTSW 17 50002669 missense probably damaging 1.00
R5853:Rftn1 UTSW 17 50047326 missense probably damaging 1.00
R6459:Rftn1 UTSW 17 50047306 missense probably benign 0.02
R6994:Rftn1 UTSW 17 50036991 missense possibly damaging 0.82
R7210:Rftn1 UTSW 17 49994307 nonsense probably null
R7283:Rftn1 UTSW 17 50047441 missense probably damaging 1.00
R7444:Rftn1 UTSW 17 50047407 missense probably damaging 1.00
R7684:Rftn1 UTSW 17 50047380
R7685:Rftn1 UTSW 17 50047380
R7686:Rftn1 UTSW 17 50047380
Predicted Primers PCR Primer
(F):5'- TGTATACTGAGGTCTTAGGCCCTG -3'
(R):5'- ACGTCTTACCGACTGCACAG -3'

Sequencing Primer
(F):5'- ATACTGAGGTCTTAGGCCCTGTTTTG -3'
(R):5'- ACTGCACAGACCATGTCGG -3'
Posted On2019-09-13