Mutagenetix > Incidental Mutations

Incidental Mutation 'R7349:Ercc5'

570397

Institutional Source

Beutler Lab

Gene Symbol

Ercc5

Ensembl Gene

ENSMUSG00000026048

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 5

Synonyms

Xpg

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7349 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44147744-44181260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 44180908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1113 (D1113E)

Ref Sequence

ENSEMBL: ENSMUSP00000027214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027214]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027214
AA Change: D1113E

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: D1113E

Domain	Start	End	E-Value	Type
XPGN	1	98	3.49e-50	SMART
low complexity region	104	115	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
low complexity region	641	650	N/A	INTRINSIC
XPGI	776	845	1.02e-33	SMART
HhH2	847	880	2.94e-11	SMART
low complexity region	1130	1140	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	T	A	13: 60,842,903	T326S	possibly damaging	Het
Acly	A	T	11: 100,521,991	H91Q	probably benign	Het
Acpp	T	A	9: 104,291,458	I403F	probably benign	Het
Angpt2	T	A	8: 18,692,074	M489L	probably damaging	Het
Arap1	T	C	7: 101,390,228	I565T	possibly damaging	Het
Atg16l2	T	C	7: 101,290,266	D563G	probably damaging	Het
Atp6v0a2	T	A	5: 124,712,328	Y386*	probably null	Het
Atp8b4	A	G	2: 126,325,345	V1078A	probably benign	Het
BC100530	A	G	16: 36,364,312	V23A	probably damaging	Het
Bsn	T	C	9: 108,110,783	D2590G	unknown	Het
Casp12	T	C	9: 5,345,527		probably null	Het
Ccdc87	T	C	19: 4,841,840	S787P	probably damaging	Het
Cdh13	A	G	8: 119,242,358	T485A	probably damaging	Het
Dip2a	T	C	10: 76,285,592	H810R	probably damaging	Het
Dmbt1	A	T	7: 131,041,124	Y120F	unknown	Het
Dmgdh	C	T	13: 93,752,233	T793I	possibly damaging	Het
Dnhd1	A	G	7: 105,710,123	D3555G	probably damaging	Het
Eif4e1b	T	C	13: 54,784,193	V30A	probably benign	Het
Fbn1	T	C	2: 125,315,401	N2321D	possibly damaging	Het
Fbrs	T	C	7: 127,482,799	L237P	probably damaging	Het
Flg2	T	A	3: 93,220,206	S2142T	unknown	Het
Ftsj3	G	A	11: 106,249,746	T761I	probably damaging	Het
Gdi2	C	A	13: 3,556,395	T157N	probably benign	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gtpbp10	T	C	5: 5,555,379	E108G	possibly damaging	Het
Hectd4	T	C	5: 121,310,663	L358P	probably damaging	Het
Herc3	T	C	6: 58,858,986	C271R	probably benign	Het
Hspb1	C	T	5: 135,889,333	T178M	possibly damaging	Het
Htr3b	C	T	9: 48,936,019	V399M	probably benign	Het
Hydin	A	G	8: 110,398,171		probably null	Het
Itpr3	T	A	17: 27,107,812		probably null	Het
Iyd	G	T	10: 3,545,638	V99F	possibly damaging	Het
Lrrc36	G	A	8: 105,452,268	G365D	probably damaging	Het
Map1b	T	A	13: 99,433,640	I858F	unknown	Het
Med12l	A	T	3: 59,258,325	D1488V	probably damaging	Het
Ms4a6c	T	A	19: 11,478,191	N121K	probably damaging	Het
Nlrp1b	T	G	11: 71,182,117	Q300P	probably benign	Het
Nlrp3	G	A	11: 59,548,086	R163H	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Olfr1411	T	C	1: 92,597,182	V221A	possibly damaging	Het
Olfr652	A	G	7: 104,564,650	H143R	probably benign	Het
Optc	T	G	1: 133,897,879	D356A	probably damaging	Het
Pdzd2	C	G	15: 12,399,205	V812L	probably damaging	Het
Phlpp2	T	C	8: 109,928,646	F691S	probably damaging	Het
Pigk	T	C	3: 152,747,601	F319L	probably benign	Het
Pkhd1l1	A	G	15: 44,514,954	T1035A	probably damaging	Het
Plekhg3	A	G	12: 76,564,565	T261A	probably benign	Het
Plekhm1	A	G	11: 103,387,334	F312S	probably damaging	Het
Pms2	T	A	5: 143,925,836	I587N	probably benign	Het
Ppl	T	A	16: 5,104,729	H272L	probably damaging	Het
Prkce	G	A	17: 86,493,355	A400T	probably benign	Het
Ptpn9	T	C	9: 57,044,376	S324P	probably benign	Het
Ptprk	A	T	10: 28,592,838	N1432I	possibly damaging	Het
R3hdm2	T	C	10: 127,492,646	S746P	probably benign	Het
Rnf220	G	A	4: 117,277,818	A412V	probably damaging	Het
Scel	G	A	14: 103,543,879	A154T	probably benign	Het
Sirpb1a	A	T	3: 15,410,604	N290K	probably damaging	Het
Sirpb1c	A	T	3: 15,832,146		probably null	Het
Sorbs2	A	T	8: 45,795,823	R704*	probably null	Het
Spast	T	C	17: 74,373,324	V427A	probably damaging	Het
Stxbp4	A	T	11: 90,592,111		probably null	Het
Thsd7a	C	A	6: 12,352,068	G1043C		Het
Tmem205	C	T	9: 21,921,114	C167Y	probably damaging	Het
Trappc9	A	T	15: 72,736,869	L897*	probably null	Het
Trim36	A	G	18: 46,169,428	F518L	probably benign	Het
Ttc12	T	G	9: 49,447,967	T402P	possibly damaging	Het
Twnk	T	C	19: 45,010,161	V506A	possibly damaging	Het
Vmn2r18	A	T	5: 151,562,217	L604*	probably null	Het
Wdr83	T	C	8: 85,079,831	N113D	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Ercc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Ercc5	APN	1	44163898	missense	probably damaging	1.00
IGL00782:Ercc5	APN	1	44163935	missense	probably damaging	1.00
IGL01418:Ercc5	APN	1	44167280	missense	probably benign	0.43
IGL01710:Ercc5	APN	1	44164075	missense	probably damaging	1.00
IGL02528:Ercc5	APN	1	44167802	missense	probably benign	0.00
IGL02589:Ercc5	APN	1	44164049	missense	probably damaging	1.00
IGL02651:Ercc5	APN	1	44156944	missense	probably damaging	1.00
IGL02740:Ercc5	APN	1	44167492	missense	probably benign	0.00
IGL02999:Ercc5	APN	1	44167654	missense	probably benign	0.00
IGL03057:Ercc5	APN	1	44167001	missense	probably damaging	0.99
IGL03246:Ercc5	APN	1	44167081	missense	probably damaging	1.00
R0084:Ercc5	UTSW	1	44175976	missense	possibly damaging	0.53
R0448:Ercc5	UTSW	1	44173940	missense	probably damaging	1.00
R1120:Ercc5	UTSW	1	44161841	missense	probably damaging	1.00
R1312:Ercc5	UTSW	1	44164019	missense	probably damaging	1.00
R1411:Ercc5	UTSW	1	44178281	missense	probably damaging	0.99
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1528:Ercc5	UTSW	1	44178241	nonsense	probably null
R1637:Ercc5	UTSW	1	44167534	missense	probably benign	0.00
R1668:Ercc5	UTSW	1	44167033	missense	probably benign	0.04
R1714:Ercc5	UTSW	1	44167339	missense	probably benign	0.01
R1780:Ercc5	UTSW	1	44167796	missense	probably benign	0.17
R1800:Ercc5	UTSW	1	44173380	missense	probably benign	0.00
R1835:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1836:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1886:Ercc5	UTSW	1	44175976	nonsense	probably null
R2344:Ercc5	UTSW	1	44167169	missense	probably benign
R2680:Ercc5	UTSW	1	44156973	missense	probably benign	0.09
R3033:Ercc5	UTSW	1	44180574	missense	possibly damaging	0.83
R3919:Ercc5	UTSW	1	44161931	missense	probably damaging	1.00
R3933:Ercc5	UTSW	1	44167856	missense	probably benign	0.17
R4444:Ercc5	UTSW	1	44158209	frame shift	probably null
R4578:Ercc5	UTSW	1	44148148	missense	probably benign	0.32
R4585:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4586:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4911:Ercc5	UTSW	1	44166871	missense	possibly damaging	0.66
R4912:Ercc5	UTSW	1	44157057	missense	probably damaging	1.00
R4942:Ercc5	UTSW	1	44175965	missense	probably benign	0.09
R5155:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
R5975:Ercc5	UTSW	1	44173406	missense	probably benign	0.04
R5991:Ercc5	UTSW	1	44180830	nonsense	probably null
R6161:Ercc5	UTSW	1	44167352	missense	probably benign	0.00
R6250:Ercc5	UTSW	1	44164049	missense	probably damaging	1.00
R7142:Ercc5	UTSW	1	44174214	missense	probably damaging	1.00
R7183:Ercc5	UTSW	1	44161808	critical splice acceptor site	probably null
R7183:Ercc5	UTSW	1	44161809	critical splice acceptor site	probably null
R7235:Ercc5	UTSW	1	44178203	missense	possibly damaging	0.68
R7369:Ercc5	UTSW	1	44180860	missense	probably benign	0.39
R7486:Ercc5	UTSW	1	44148064	start codon destroyed	probably null	1.00
R7586:Ercc5	UTSW	1	44175851	missense	possibly damaging	0.49
R7904:Ercc5	UTSW	1	44175838	critical splice acceptor site	probably null
R7994:Ercc5	UTSW	1	44178334	missense	possibly damaging	0.94
R8432:Ercc5	UTSW	1	44167681	nonsense	probably null
R8795:Ercc5	UTSW	1	44163929	missense	possibly damaging	0.92
R9144:Ercc5	UTSW	1	44174351	missense	probably damaging	1.00
R9208:Ercc5	UTSW	1	44178343	missense	possibly damaging	0.51
R9295:Ercc5	UTSW	1	44158857	missense	probably damaging	1.00
X0011:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
X0062:Ercc5	UTSW	1	44173974	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGCCCTGGATGATGCAAAAG -3'
(R):5'- CTTTTGTGTGCGGATAACAATATGG -3'

Sequencing Primer
(F):5'- CTGGATGATGCAAAAGGAAAAACCC -3'
(R):5'- TGGAGCTACTAGTGGACA -3'

Posted On

2019-09-13