Incidental Mutation 'R7349:Atp8b4'
ID570401
Institutional Source Beutler Lab
Gene Symbol Atp8b4
Ensembl Gene ENSMUSG00000060131
Gene NameATPase, class I, type 8B, member 4
SynonymsIm
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7349 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126320973-126500674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126325345 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1078 (V1078A)
Ref Sequence ENSEMBL: ENSMUSP00000047302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040128] [ENSMUST00000040149]
Predicted Effect probably benign
Transcript: ENSMUST00000040128
AA Change: V1078A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131
AA Change: V1078A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040149
AA Change: V1078A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000047302
Gene: ENSMUSG00000060131
AA Change: V1078A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cation transport ATPase (P-type) family and type IV subfamily. The encoded protein is involved in phospholipid transport in the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dmgdh C T 13: 93,752,233 T793I possibly damaging Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Eif4e1b T C 13: 54,784,193 V30A probably benign Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Ftsj3 G A 11: 106,249,746 T761I probably damaging Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp1b T G 11: 71,182,117 Q300P probably benign Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Rnf220 G A 4: 117,277,818 A412V probably damaging Het
Scel G A 14: 103,543,879 A154T probably benign Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sirpb1c A T 3: 15,832,146 probably null Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Atp8b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Atp8b4 APN 2 126358897 missense probably damaging 1.00
IGL00841:Atp8b4 APN 2 126383769 missense probably damaging 0.97
IGL00917:Atp8b4 APN 2 126374533 missense probably benign 0.00
IGL01013:Atp8b4 APN 2 126323087 missense probably benign 0.25
IGL01374:Atp8b4 APN 2 126383657 splice site probably benign
IGL01898:Atp8b4 APN 2 126389361 missense probably benign 0.00
IGL01927:Atp8b4 APN 2 126322976 missense probably damaging 0.99
IGL01971:Atp8b4 APN 2 126462616 missense probably benign 0.05
R0320:Atp8b4 UTSW 2 126459694 missense possibly damaging 0.55
R0441:Atp8b4 UTSW 2 126378706 splice site probably benign
R0526:Atp8b4 UTSW 2 126427363 missense probably damaging 1.00
R0765:Atp8b4 UTSW 2 126372150 splice site probably null
R0964:Atp8b4 UTSW 2 126337493 missense probably damaging 1.00
R1386:Atp8b4 UTSW 2 126378744 missense probably benign 0.00
R1401:Atp8b4 UTSW 2 126323093 critical splice acceptor site probably null
R1568:Atp8b4 UTSW 2 126325394 missense probably benign
R1792:Atp8b4 UTSW 2 126325294 missense probably benign
R1830:Atp8b4 UTSW 2 126403381 missense probably benign 0.03
R1839:Atp8b4 UTSW 2 126361782 missense possibly damaging 0.92
R1984:Atp8b4 UTSW 2 126323008 missense probably damaging 1.00
R2143:Atp8b4 UTSW 2 126374510 missense probably damaging 1.00
R2186:Atp8b4 UTSW 2 126358860 missense probably damaging 1.00
R2212:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R2473:Atp8b4 UTSW 2 126358894 missense possibly damaging 0.67
R3412:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R3414:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R4519:Atp8b4 UTSW 2 126414459 splice site probably null
R4543:Atp8b4 UTSW 2 126358066 missense probably damaging 0.97
R4701:Atp8b4 UTSW 2 126414293 missense probably damaging 1.00
R4818:Atp8b4 UTSW 2 126322816 missense probably benign 0.01
R4895:Atp8b4 UTSW 2 126414369 missense probably benign 0.23
R5213:Atp8b4 UTSW 2 126389409 splice site probably null
R5239:Atp8b4 UTSW 2 126392861 splice site probably null
R5241:Atp8b4 UTSW 2 126383726 missense probably benign
R5654:Atp8b4 UTSW 2 126375805 missense probably damaging 1.00
R5725:Atp8b4 UTSW 2 126433936 missense probably benign
R5771:Atp8b4 UTSW 2 126378744 missense probably benign 0.11
R5949:Atp8b4 UTSW 2 126405322 missense probably benign 0.02
R5993:Atp8b4 UTSW 2 126403234 missense probably benign
R5998:Atp8b4 UTSW 2 126433867 splice site probably null
R6550:Atp8b4 UTSW 2 126424193 missense probably damaging 1.00
R6575:Atp8b4 UTSW 2 126414364 missense probably damaging 1.00
R6892:Atp8b4 UTSW 2 126343002 missense possibly damaging 0.94
R6915:Atp8b4 UTSW 2 126358914 nonsense probably null
R7045:Atp8b4 UTSW 2 126372195 missense probably benign 0.00
R7206:Atp8b4 UTSW 2 126458292 missense probably damaging 0.99
R7395:Atp8b4 UTSW 2 126375694 missense possibly damaging 0.76
R7429:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7430:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7548:Atp8b4 UTSW 2 126389342 missense probably benign
R7724:Atp8b4 UTSW 2 126322893 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAAATTCCCTTAGTCATTCCTGTGC -3'
(R):5'- ATCAGGTTAGCACTTCCCCG -3'

Sequencing Primer
(F):5'- TGCCTCTGTTTGGAAAGAGAAG -3'
(R):5'- CGGGCTTTCCTAATCGTGTCAAAG -3'
Posted On2019-09-13