Incidental Mutation 'R7349:Sirpb1c'
ID570403
Institutional Source Beutler Lab
Gene Symbol Sirpb1c
Ensembl Gene ENSMUSG00000074677
Gene Namesignal-regulatory protein beta 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7349 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location15795145-15848528 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 15832146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050623] [ENSMUST00000108349] [ENSMUST00000108350] [ENSMUST00000108352] [ENSMUST00000108354] [ENSMUST00000108354]
Predicted Effect probably null
Transcript: ENSMUST00000050623
SMART Domains Protein: ENSMUSP00000061216
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000108349
SMART Domains Protein: ENSMUSP00000103986
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 35 141 3.51e-8 SMART
IGc1 161 234 4.07e-4 SMART
IGc1 264 337 2.21e-5 SMART
Predicted Effect silent
Transcript: ENSMUST00000108350
SMART Domains Protein: ENSMUSP00000103987
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect silent
Transcript: ENSMUST00000108352
SMART Domains Protein: ENSMUSP00000103989
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108354
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108354
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect silent
Transcript: ENSMUST00000148194
SMART Domains Protein: ENSMUSP00000120527
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
IGc1 32 105 4.07e-4 SMART
IGc1 135 208 2.21e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
Atp8b4 A G 2: 126,325,345 V1078A probably benign Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dmgdh C T 13: 93,752,233 T793I possibly damaging Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Eif4e1b T C 13: 54,784,193 V30A probably benign Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Ftsj3 G A 11: 106,249,746 T761I probably damaging Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp1b T G 11: 71,182,117 Q300P probably benign Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Rnf220 G A 4: 117,277,818 A412V probably damaging Het
Scel G A 14: 103,543,879 A154T probably benign Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Sirpb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Sirpb1c APN 3 15838773 missense probably benign 0.06
R0094:Sirpb1c UTSW 3 15838758 missense possibly damaging 0.73
R0356:Sirpb1c UTSW 3 15833145 missense possibly damaging 0.95
R0442:Sirpb1c UTSW 3 15802546 missense probably benign 0.09
R3731:Sirpb1c UTSW 3 15833123 missense probably damaging 1.00
R4812:Sirpb1c UTSW 3 15833222 missense probably damaging 0.99
R5802:Sirpb1c UTSW 3 15832076 missense probably benign 0.00
R6315:Sirpb1c UTSW 3 15832306 missense possibly damaging 0.71
R7107:Sirpb1c UTSW 3 15838777 missense possibly damaging 0.91
R7148:Sirpb1c UTSW 3 15833059 nonsense probably null
R7356:Sirpb1c UTSW 3 15832133 missense probably benign
R7359:Sirpb1c UTSW 3 15833225 missense probably benign 0.02
R7466:Sirpb1c UTSW 3 15832266 missense probably damaging 1.00
R7629:Sirpb1c UTSW 3 15848395 missense possibly damaging 0.86
R7720:Sirpb1c UTSW 3 15832072 missense probably benign 0.00
R7726:Sirpb1c UTSW 3 15848386 missense possibly damaging 0.92
R7853:Sirpb1c UTSW 3 15832992 missense probably damaging 1.00
R7886:Sirpb1c UTSW 3 15832202 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCTATTAGTGGAAAGATATGTGAGACG -3'
(R):5'- CCTCCAAGGTTTCAGGTGACC -3'

Sequencing Primer
(F):5'- ATATGTGAGACGTGTGAGAAGTTG -3'
(R):5'- TCCCGGAGAGAAGTACCTTTTAC -3'
Posted On2019-09-13