Incidental Mutation 'R7349:Rnf220'
ID570408
Institutional Source Beutler Lab
Gene Symbol Rnf220
Ensembl Gene ENSMUSG00000028677
Gene Namering finger protein 220
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R7349 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117271463-117497052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117277818 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 412 (A412V)
Ref Sequence ENSEMBL: ENSMUSP00000030439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030439] [ENSMUST00000094853] [ENSMUST00000102690] [ENSMUST00000221654]
Predicted Effect probably damaging
Transcript: ENSMUST00000030439
AA Change: A412V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030439
Gene: ENSMUSG00000028677
AA Change: A412V

DomainStartEndE-ValueType
Pfam:RNF220 217 339 3.5e-38 PFAM
Pfam:RNF220 325 444 4.9e-51 PFAM
RING 514 552 1.62e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094853
AA Change: A199V

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092449
Gene: ENSMUSG00000028677
AA Change: A199V

DomainStartEndE-ValueType
low complexity region 176 187 N/A INTRINSIC
RING 301 339 1.62e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102690
AA Change: A91V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099751
Gene: ENSMUSG00000028677
AA Change: A91V

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
RING 193 231 1.62e-1 SMART
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000221654
AA Change: A154V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
Atp8b4 A G 2: 126,325,345 V1078A probably benign Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dmgdh C T 13: 93,752,233 T793I possibly damaging Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Eif4e1b T C 13: 54,784,193 V30A probably benign Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Ftsj3 G A 11: 106,249,746 T761I probably damaging Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp1b T G 11: 71,182,117 Q300P probably benign Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Scel G A 14: 103,543,879 A154T probably benign Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sirpb1c A T 3: 15,832,146 probably null Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Rnf220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rnf220 APN 4 117307675 missense probably benign 0.02
IGL01345:Rnf220 APN 4 117273270 nonsense probably null
IGL02097:Rnf220 APN 4 117273327 missense probably benign 0.00
IGL02245:Rnf220 APN 4 117299537 splice site probably benign
IGL02366:Rnf220 APN 4 117489783 missense probably benign
IGL02725:Rnf220 APN 4 117272379 splice site probably benign
IGL02801:Rnf220 APN 4 117273251 missense probably damaging 1.00
IGL02963:Rnf220 APN 4 117490192 missense probably damaging 0.97
BB007:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
BB017:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
PIT4131001:Rnf220 UTSW 4 117277369 critical splice donor site probably null
R0041:Rnf220 UTSW 4 117273284 missense probably damaging 1.00
R0784:Rnf220 UTSW 4 117277998 splice site probably benign
R1107:Rnf220 UTSW 4 117285390 missense probably damaging 1.00
R1122:Rnf220 UTSW 4 117278080 missense probably benign 0.01
R1231:Rnf220 UTSW 4 117489884 missense probably damaging 0.98
R1708:Rnf220 UTSW 4 117489886 missense probably benign 0.00
R1794:Rnf220 UTSW 4 117307568 missense probably benign
R4488:Rnf220 UTSW 4 117489814 missense probably damaging 1.00
R4710:Rnf220 UTSW 4 117289214 unclassified probably benign
R4790:Rnf220 UTSW 4 117289055 missense probably benign 0.45
R4923:Rnf220 UTSW 4 117489600 missense possibly damaging 0.71
R5173:Rnf220 UTSW 4 117289274 start gained probably benign
R5334:Rnf220 UTSW 4 117272351 missense probably damaging 1.00
R5505:Rnf220 UTSW 4 117296091 intron probably benign
R5849:Rnf220 UTSW 4 117277612 missense possibly damaging 0.92
R7075:Rnf220 UTSW 4 117285882 missense probably benign 0.28
R7478:Rnf220 UTSW 4 117296136 missense possibly damaging 0.94
R7541:Rnf220 UTSW 4 117489930 missense probably damaging 1.00
R7930:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
R8030:Rnf220 UTSW 4 117277828 missense probably damaging 1.00
R8202:Rnf220 UTSW 4 117489873 missense probably damaging 1.00
R8701:Rnf220 UTSW 4 117489993 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAACTCAGGTGTGATGCGG -3'
(R):5'- GTATCCTTGGGGCAAAGTGG -3'

Sequencing Primer
(F):5'- TCGGAGGGCCACCACTAGAG -3'
(R):5'- GGGCAAGCCAGCAGTAAC -3'
Posted On2019-09-13