Incidental Mutation 'R7349:Nlrp1b'
ID570442
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7349 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 71182117 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 300 (Q300P)
Ref Sequence ENSEMBL: ENSMUSP00000104155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108514] [ENSMUST00000108515] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably benign
Transcript: ENSMUST00000094046
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108514
AA Change: Q300P

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104154
Gene: ENSMUSG00000070390
AA Change: Q300P

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.1e-40 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 814 1068 2.4e-136 PFAM
Pfam:CARD 1086 1169 3.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108515
AA Change: Q300P

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104155
Gene: ENSMUSG00000070390
AA Change: Q300P

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.9e-41 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 815 1067 5e-104 PFAM
Pfam:CARD 1086 1169 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
Atp8b4 A G 2: 126,325,345 V1078A probably benign Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dmgdh C T 13: 93,752,233 T793I possibly damaging Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Eif4e1b T C 13: 54,784,193 V30A probably benign Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Ftsj3 G A 11: 106,249,746 T761I probably damaging Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Rnf220 G A 4: 117,277,818 A412V probably damaging Het
Scel G A 14: 103,543,879 A154T probably benign Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sirpb1c A T 3: 15,832,146 probably null Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R7994:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71216921 missense probably benign 0.15
Z1176:Nlrp1b UTSW 11 71182270 missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71181299 nonsense probably null
Z1177:Nlrp1b UTSW 11 71217224 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGCTGGGTCCTCATATGATG -3'
(R):5'- GTGCACACACTACTGGGAAG -3'

Sequencing Primer
(F):5'- CCTCATATGATGCACTGGGATTG -3'
(R):5'- GTGCACACACTACTGGGAAGTTTAC -3'
Posted On2019-09-13