Incidental Mutation 'R7349:Ftsj3'
ID570445
Institutional Source Beutler Lab
Gene Symbol Ftsj3
Ensembl Gene ENSMUSG00000020706
Gene NameFtsJ RNA methyltransferase homolog 3 (E. coli)
SynonymsD11Ertd400e, C79843, Epcs3
MMRRC Submission
Accession Numbers

Genbank: NM_025310; MGI: 1860295

Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7349 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106249142-106256079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106249746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 761 (T761I)
Ref Sequence ENSEMBL: ENSMUSP00000021048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046] [ENSMUST00000021048]
Predicted Effect probably benign
Transcript: ENSMUST00000021046
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000021048
AA Change: T761I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021048
Gene: ENSMUSG00000020706
AA Change: T761I

DomainStartEndE-ValueType
Pfam:FtsJ 24 200 2.8e-56 PFAM
low complexity region 203 218 N/A INTRINSIC
Pfam:DUF3381 231 398 1.3e-48 PFAM
low complexity region 456 475 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
Pfam:Spb1_C 597 831 1.8e-72 PFAM
Meta Mutation Damage Score 0.2629 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the function of this gene is not known, the existence of this gene is supported by mRNA and EST data. A possible function of the encoded protein can be inferred from amino acid sequence similarity to the E.coli FtsJ protein and to a mouse protein possibly involved in embryogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(10) : Targeted(2) Gene trapped(8)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
Atp8b4 A G 2: 126,325,345 V1078A probably benign Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dmgdh C T 13: 93,752,233 T793I possibly damaging Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Eif4e1b T C 13: 54,784,193 V30A probably benign Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp1b T G 11: 71,182,117 Q300P probably benign Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Rnf220 G A 4: 117,277,818 A412V probably damaging Het
Scel G A 14: 103,543,879 A154T probably benign Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sirpb1c A T 3: 15,832,146 probably null Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Ftsj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ftsj3 APN 11 106250179 missense probably damaging 0.99
IGL00964:Ftsj3 APN 11 106253115 missense probably benign 0.00
IGL01025:Ftsj3 APN 11 106250359 missense probably damaging 0.98
IGL01101:Ftsj3 APN 11 106255632 missense probably benign 0.16
IGL01370:Ftsj3 APN 11 106252319 missense possibly damaging 0.79
IGL02000:Ftsj3 APN 11 106250407 missense probably benign 0.03
IGL02139:Ftsj3 APN 11 106254663 missense possibly damaging 0.91
IGL02340:Ftsj3 APN 11 106253146 nonsense probably null
IGL02964:Ftsj3 APN 11 106252337 missense probably damaging 1.00
IGL03136:Ftsj3 APN 11 106253813 missense probably damaging 1.00
D4043:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
LCD18:Ftsj3 UTSW 11 106250059 splice site probably benign
NA:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
P0018:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
P0027:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
PIT4581001:Ftsj3 UTSW 11 106249476 missense unknown
R1449:Ftsj3 UTSW 11 106253000 missense probably benign 0.28
R2242:Ftsj3 UTSW 11 106250778 missense probably benign 0.45
R4086:Ftsj3 UTSW 11 106249569 missense probably damaging 1.00
R4356:Ftsj3 UTSW 11 106253676 missense probably benign 0.01
R4358:Ftsj3 UTSW 11 106253676 missense probably benign 0.01
R4943:Ftsj3 UTSW 11 106249518 missense probably damaging 1.00
R5520:Ftsj3 UTSW 11 106255588 missense probably benign 0.05
R5997:Ftsj3 UTSW 11 106252251 missense probably damaging 0.99
R6047:Ftsj3 UTSW 11 106252318 missense probably damaging 0.96
R6180:Ftsj3 UTSW 11 106253340 synonymous probably null
R6771:Ftsj3 UTSW 11 106249540 missense probably damaging 1.00
R7121:Ftsj3 UTSW 11 106252297 missense probably damaging 1.00
R7303:Ftsj3 UTSW 11 106254680 missense probably damaging 1.00
R7559:Ftsj3 UTSW 11 106252987 missense possibly damaging 0.55
R7782:Ftsj3 UTSW 11 106252551 unclassified probably benign
R7783:Ftsj3 UTSW 11 106252551 unclassified probably benign
R7899:Ftsj3 UTSW 11 106252289 nonsense probably null
R7982:Ftsj3 UTSW 11 106252289 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGACCTTTGACTCCAGCTGG -3'
(R):5'- CCCATCAAGAAAGTAGCTGAGG -3'

Sequencing Primer
(F):5'- CAACATAAGTGACCTGGCGTTTC -3'
(R):5'- GTAGCTGAGGCCAAGGC -3'
Posted On2019-09-13