Incidental Mutation 'R7349:Eif4e1b'
ID570448
Institutional Source Beutler Lab
Gene Symbol Eif4e1b
Ensembl Gene ENSMUSG00000074895
Gene Nameeukaryotic translation initiation factor 4E family member 1B
SynonymsEif4eloo
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7349 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54783998-54788459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54784193 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000120733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110003] [ENSMUST00000126525] [ENSMUST00000126785] [ENSMUST00000132005] [ENSMUST00000132415] [ENSMUST00000132728] [ENSMUST00000139184] [ENSMUST00000141398] [ENSMUST00000142158] [ENSMUST00000152204]
Predicted Effect probably benign
Transcript: ENSMUST00000110003
SMART Domains Protein: ENSMUSP00000105630
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 227 2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126525
AA Change: V30A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121625
Gene: ENSMUSG00000074895
AA Change: V30A

DomainStartEndE-ValueType
Pfam:IF4E 63 111 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126785
SMART Domains Protein: ENSMUSP00000118697
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:IF4E 72 234 1.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132005
SMART Domains Protein: ENSMUSP00000116681
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 175 3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132415
AA Change: V30A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120733
Gene: ENSMUSG00000074895
AA Change: V30A

DomainStartEndE-ValueType
Pfam:IF4E 63 162 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132728
SMART Domains Protein: ENSMUSP00000123294
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 228 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139184
SMART Domains Protein: ENSMUSP00000119305
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 134 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141398
SMART Domains Protein: ENSMUSP00000114217
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
Pfam:IF4E 1 90 6.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142158
SMART Domains Protein: ENSMUSP00000117092
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 233 4.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152204
SMART Domains Protein: ENSMUSP00000120619
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 170 9.1e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
Atp8b4 A G 2: 126,325,345 V1078A probably benign Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dmgdh C T 13: 93,752,233 T793I possibly damaging Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Ftsj3 G A 11: 106,249,746 T761I probably damaging Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp1b T G 11: 71,182,117 Q300P probably benign Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Rnf220 G A 4: 117,277,818 A412V probably damaging Het
Scel G A 14: 103,543,879 A154T probably benign Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sirpb1c A T 3: 15,832,146 probably null Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Eif4e1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Eif4e1b APN 13 54786916 missense probably damaging 1.00
R1766:Eif4e1b UTSW 13 54786891 missense probably damaging 0.98
R1858:Eif4e1b UTSW 13 54787278 unclassified probably null
R4130:Eif4e1b UTSW 13 54787317 missense probably benign 0.25
R4426:Eif4e1b UTSW 13 54784483 missense probably benign 0.01
R4702:Eif4e1b UTSW 13 54787325 missense probably damaging 0.99
R5367:Eif4e1b UTSW 13 54786944 missense probably damaging 0.99
R5595:Eif4e1b UTSW 13 54786716 missense possibly damaging 0.49
R5976:Eif4e1b UTSW 13 54784822 missense probably damaging 1.00
R6195:Eif4e1b UTSW 13 54784205 missense probably null 0.13
R6574:Eif4e1b UTSW 13 54784898 missense probably damaging 1.00
R6610:Eif4e1b UTSW 13 54784315 intron probably benign
R6980:Eif4e1b UTSW 13 54784103 critical splice donor site probably null
R7131:Eif4e1b UTSW 13 54784100 missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- TGAGGTTGTGAGTCTACCCC -3'
(R):5'- CTCCGCAGTTGCTTCTGATG -3'

Sequencing Primer
(F):5'- GGTTGTGAGTCTACCCCATCCG -3'
(R):5'- CAGTTGCTTCTGATGGCTTTTC -3'
Posted On2019-09-13