Incidental Mutation 'R7349:Dmgdh'
ID570450
Institutional Source Beutler Lab
Gene Symbol Dmgdh
Ensembl Gene ENSMUSG00000042102
Gene Namedimethylglycine dehydrogenase precursor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7349 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93674433-93752833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93752233 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 793 (T793I)
Ref Sequence ENSEMBL: ENSMUSP00000039663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048001
AA Change: T793I

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039663
Gene: ENSMUSG00000042102
AA Change: T793I

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DAO 44 407 9.3e-64 PFAM
Pfam:FAO_M 410 464 1e-15 PFAM
Pfam:GCV_T 468 738 3.6e-72 PFAM
Pfam:SoxG 559 697 1.3e-10 PFAM
Pfam:GCV_T_C 745 838 3.9e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the catabolism of choline, catalyzing the oxidative demethylation of dimethylglycine to form sarcosine. The enzyme is found as a monomer in the mitochondrial matrix, and uses flavin adenine dinucleotide and folate as cofactors. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
Atp8b4 A G 2: 126,325,345 V1078A probably benign Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Eif4e1b T C 13: 54,784,193 V30A probably benign Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Ftsj3 G A 11: 106,249,746 T761I probably damaging Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp1b T G 11: 71,182,117 Q300P probably benign Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Rnf220 G A 4: 117,277,818 A412V probably damaging Het
Scel G A 14: 103,543,879 A154T probably benign Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sirpb1c A T 3: 15,832,146 probably null Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Dmgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Dmgdh APN 13 93703778 splice site probably benign
IGL01406:Dmgdh APN 13 93687031 splice site probably benign
IGL01408:Dmgdh APN 13 93709295 missense probably damaging 1.00
IGL02167:Dmgdh APN 13 93720627 splice site probably benign
IGL02538:Dmgdh APN 13 93708753 missense possibly damaging 0.50
IGL02550:Dmgdh APN 13 93717575 missense probably damaging 1.00
IGL02563:Dmgdh APN 13 93674539 splice site probably benign
IGL02668:Dmgdh APN 13 93703910 missense probably damaging 1.00
IGL02889:Dmgdh APN 13 93715677 critical splice donor site probably null
IGL03293:Dmgdh APN 13 93706701 missense probably benign 0.11
R0646:Dmgdh UTSW 13 93752355 missense probably benign 0.04
R1531:Dmgdh UTSW 13 93744411 missense probably damaging 1.00
R1746:Dmgdh UTSW 13 93752425 missense probably benign
R1795:Dmgdh UTSW 13 93706699 missense probably benign
R1943:Dmgdh UTSW 13 93711370 missense probably benign 0.08
R1959:Dmgdh UTSW 13 93720559 missense probably benign 0.01
R3421:Dmgdh UTSW 13 93711361 missense probably benign 0.01
R3727:Dmgdh UTSW 13 93692067 missense probably damaging 1.00
R4523:Dmgdh UTSW 13 93688630 nonsense probably null
R5000:Dmgdh UTSW 13 93688538 missense probably damaging 1.00
R5589:Dmgdh UTSW 13 93677157 missense probably damaging 1.00
R5913:Dmgdh UTSW 13 93752323 missense possibly damaging 0.92
R6056:Dmgdh UTSW 13 93708743 missense possibly damaging 0.67
R6056:Dmgdh UTSW 13 93752326 missense probably damaging 1.00
R6057:Dmgdh UTSW 13 93752452 missense probably benign 0.00
R6180:Dmgdh UTSW 13 93752286 missense possibly damaging 0.61
R6259:Dmgdh UTSW 13 93752308 missense probably benign 0.01
R6608:Dmgdh UTSW 13 93706744 missense possibly damaging 0.81
R6636:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6637:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6739:Dmgdh UTSW 13 93720615 missense probably benign 0.07
R7157:Dmgdh UTSW 13 93715535 missense probably damaging 1.00
R7200:Dmgdh UTSW 13 93691885 missense probably damaging 1.00
R7312:Dmgdh UTSW 13 93708846 splice site probably null
R8087:Dmgdh UTSW 13 93703871 missense possibly damaging 0.95
R8288:Dmgdh UTSW 13 93708824 missense probably damaging 1.00
R8290:Dmgdh UTSW 13 93706736 missense probably benign 0.05
R8371:Dmgdh UTSW 13 93708730 missense probably benign 0.00
R8469:Dmgdh UTSW 13 93706667 missense probably damaging 1.00
R8768:Dmgdh UTSW 13 93688610 missense possibly damaging 0.52
X0066:Dmgdh UTSW 13 93752374 missense possibly damaging 0.90
Z1177:Dmgdh UTSW 13 93677183 missense probably damaging 0.96
Z1177:Dmgdh UTSW 13 93709288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAACTATTTCAGGGTGAGAC -3'
(R):5'- CAACTTGGTTGTCCGGGATG -3'

Sequencing Primer
(F):5'- GTGAGACCCACAATTCTGTACACTG -3'
(R):5'- ACCGTCTTTCTGAAGCCTGG -3'
Posted On2019-09-13