Mutagenetix > Incidental Mutation

Incidental Mutation 'R7349:Map1b'

570451

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7349 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 99433640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 858 (I858F)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: I858F

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: I858F

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	T	A	13: 60,842,903	T326S	possibly damaging	Het
Acly	A	T	11: 100,521,991	H91Q	probably benign	Het
Acpp	T	A	9: 104,291,458	I403F	probably benign	Het
Angpt2	T	A	8: 18,692,074	M489L	probably damaging	Het
Arap1	T	C	7: 101,390,228	I565T	possibly damaging	Het
Atg16l2	T	C	7: 101,290,266	D563G	probably damaging	Het
Atp6v0a2	T	A	5: 124,712,328	Y386*	probably null	Het
Atp8b4	A	G	2: 126,325,345	V1078A	probably benign	Het
BC100530	A	G	16: 36,364,312	V23A	probably damaging	Het
Bsn	T	C	9: 108,110,783	D2590G	unknown	Het
Casp12	T	C	9: 5,345,527		probably null	Het
Ccdc87	T	C	19: 4,841,840	S787P	probably damaging	Het
Cdh13	A	G	8: 119,242,358	T485A	probably damaging	Het
Dip2a	T	C	10: 76,285,592	H810R	probably damaging	Het
Dmbt1	A	T	7: 131,041,124	Y120F	unknown	Het
Dmgdh	C	T	13: 93,752,233	T793I	possibly damaging	Het
Dnhd1	A	G	7: 105,710,123	D3555G	probably damaging	Het
Eif4e1b	T	C	13: 54,784,193	V30A	probably benign	Het
Ercc5	T	G	1: 44,180,908	D1113E	possibly damaging	Het
Fbn1	T	C	2: 125,315,401	N2321D	possibly damaging	Het
Fbrs	T	C	7: 127,482,799	L237P	probably damaging	Het
Flg2	T	A	3: 93,220,206	S2142T	unknown	Het
Ftsj3	G	A	11: 106,249,746	T761I	probably damaging	Het
Gdi2	C	A	13: 3,556,395	T157N	probably benign	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gtpbp10	T	C	5: 5,555,379	E108G	possibly damaging	Het
Hectd4	T	C	5: 121,310,663	L358P	probably damaging	Het
Herc3	T	C	6: 58,858,986	C271R	probably benign	Het
Hspb1	C	T	5: 135,889,333	T178M	possibly damaging	Het
Htr3b	C	T	9: 48,936,019	V399M	probably benign	Het
Hydin	A	G	8: 110,398,171		probably null	Het
Itpr3	T	A	17: 27,107,812		probably null	Het
Iyd	G	T	10: 3,545,638	V99F	possibly damaging	Het
Lrrc36	G	A	8: 105,452,268	G365D	probably damaging	Het
Med12l	A	T	3: 59,258,325	D1488V	probably damaging	Het
Ms4a6c	T	A	19: 11,478,191	N121K	probably damaging	Het
Nlrp1b	T	G	11: 71,182,117	Q300P	probably benign	Het
Nlrp3	G	A	11: 59,548,086	R163H	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Olfr1411	T	C	1: 92,597,182	V221A	possibly damaging	Het
Olfr652	A	G	7: 104,564,650	H143R	probably benign	Het
Optc	T	G	1: 133,897,879	D356A	probably damaging	Het
Pdzd2	C	G	15: 12,399,205	V812L	probably damaging	Het
Phlpp2	T	C	8: 109,928,646	F691S	probably damaging	Het
Pigk	T	C	3: 152,747,601	F319L	probably benign	Het
Pkhd1l1	A	G	15: 44,514,954	T1035A	probably damaging	Het
Plekhg3	A	G	12: 76,564,565	T261A	probably benign	Het
Plekhm1	A	G	11: 103,387,334	F312S	probably damaging	Het
Pms2	T	A	5: 143,925,836	I587N	probably benign	Het
Ppl	T	A	16: 5,104,729	H272L	probably damaging	Het
Prkce	G	A	17: 86,493,355	A400T	probably benign	Het
Ptpn9	T	C	9: 57,044,376	S324P	probably benign	Het
Ptprk	A	T	10: 28,592,838	N1432I	possibly damaging	Het
R3hdm2	T	C	10: 127,492,646	S746P	probably benign	Het
Rnf220	G	A	4: 117,277,818	A412V	probably damaging	Het
Scel	G	A	14: 103,543,879	A154T	probably benign	Het
Sirpb1a	A	T	3: 15,410,604	N290K	probably damaging	Het
Sirpb1c	A	T	3: 15,832,146		probably null	Het
Sorbs2	A	T	8: 45,795,823	R704*	probably null	Het
Spast	T	C	17: 74,373,324	V427A	probably damaging	Het
Stxbp4	A	T	11: 90,592,111		probably null	Het
Thsd7a	C	A	6: 12,352,068	G1043C		Het
Tmem205	C	T	9: 21,921,114	C167Y	probably damaging	Het
Trappc9	A	T	15: 72,736,869	L897*	probably null	Het
Trim36	A	G	18: 46,169,428	F518L	probably benign	Het
Ttc12	T	G	9: 49,447,967	T402P	possibly damaging	Het
Twnk	T	C	19: 45,010,161	V506A	possibly damaging	Het
Vmn2r18	A	T	5: 151,562,217	L604*	probably null	Het
Wdr83	T	C	8: 85,079,831	N113D	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TCAATGTCATCCACGCCCTG -3'
(R):5'- TGCTGGGAAACTCAAGGAC -3'

Sequencing Primer
(F):5'- ACGCCCTGCTTCTCAACTGG -3'
(R):5'- ACAGCTGTTGGCACTGC -3'

Posted On

2019-09-13