Incidental Mutation 'R7349:Scel'
ID570454
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7349 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103543879 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 154 (A154T)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: A154T

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: A154T

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: A154T

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,842,903 T326S possibly damaging Het
Acly A T 11: 100,521,991 H91Q probably benign Het
Acpp T A 9: 104,291,458 I403F probably benign Het
Angpt2 T A 8: 18,692,074 M489L probably damaging Het
Arap1 T C 7: 101,390,228 I565T possibly damaging Het
Atg16l2 T C 7: 101,290,266 D563G probably damaging Het
Atp6v0a2 T A 5: 124,712,328 Y386* probably null Het
Atp8b4 A G 2: 126,325,345 V1078A probably benign Het
BC100530 A G 16: 36,364,312 V23A probably damaging Het
Bsn T C 9: 108,110,783 D2590G unknown Het
Casp12 T C 9: 5,345,527 probably null Het
Ccdc87 T C 19: 4,841,840 S787P probably damaging Het
Cdh13 A G 8: 119,242,358 T485A probably damaging Het
Dip2a T C 10: 76,285,592 H810R probably damaging Het
Dmbt1 A T 7: 131,041,124 Y120F unknown Het
Dmgdh C T 13: 93,752,233 T793I possibly damaging Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Eif4e1b T C 13: 54,784,193 V30A probably benign Het
Ercc5 T G 1: 44,180,908 D1113E possibly damaging Het
Fbn1 T C 2: 125,315,401 N2321D possibly damaging Het
Fbrs T C 7: 127,482,799 L237P probably damaging Het
Flg2 T A 3: 93,220,206 S2142T unknown Het
Ftsj3 G A 11: 106,249,746 T761I probably damaging Het
Gdi2 C A 13: 3,556,395 T157N probably benign Het
Gm8122 C A 14: 43,230,601 probably null Het
Gtpbp10 T C 5: 5,555,379 E108G possibly damaging Het
Hectd4 T C 5: 121,310,663 L358P probably damaging Het
Herc3 T C 6: 58,858,986 C271R probably benign Het
Hspb1 C T 5: 135,889,333 T178M possibly damaging Het
Htr3b C T 9: 48,936,019 V399M probably benign Het
Hydin A G 8: 110,398,171 probably null Het
Itpr3 T A 17: 27,107,812 probably null Het
Iyd G T 10: 3,545,638 V99F possibly damaging Het
Lrrc36 G A 8: 105,452,268 G365D probably damaging Het
Map1b T A 13: 99,433,640 I858F unknown Het
Med12l A T 3: 59,258,325 D1488V probably damaging Het
Ms4a6c T A 19: 11,478,191 N121K probably damaging Het
Nlrp1b T G 11: 71,182,117 Q300P probably benign Het
Nlrp3 G A 11: 59,548,086 R163H probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1411 T C 1: 92,597,182 V221A possibly damaging Het
Olfr652 A G 7: 104,564,650 H143R probably benign Het
Optc T G 1: 133,897,879 D356A probably damaging Het
Pdzd2 C G 15: 12,399,205 V812L probably damaging Het
Phlpp2 T C 8: 109,928,646 F691S probably damaging Het
Pigk T C 3: 152,747,601 F319L probably benign Het
Pkhd1l1 A G 15: 44,514,954 T1035A probably damaging Het
Plekhg3 A G 12: 76,564,565 T261A probably benign Het
Plekhm1 A G 11: 103,387,334 F312S probably damaging Het
Pms2 T A 5: 143,925,836 I587N probably benign Het
Ppl T A 16: 5,104,729 H272L probably damaging Het
Prkce G A 17: 86,493,355 A400T probably benign Het
Ptpn9 T C 9: 57,044,376 S324P probably benign Het
Ptprk A T 10: 28,592,838 N1432I possibly damaging Het
R3hdm2 T C 10: 127,492,646 S746P probably benign Het
Rnf220 G A 4: 117,277,818 A412V probably damaging Het
Sirpb1a A T 3: 15,410,604 N290K probably damaging Het
Sirpb1c A T 3: 15,832,146 probably null Het
Sorbs2 A T 8: 45,795,823 R704* probably null Het
Spast T C 17: 74,373,324 V427A probably damaging Het
Stxbp4 A T 11: 90,592,111 probably null Het
Thsd7a C A 6: 12,352,068 G1043C Het
Tmem205 C T 9: 21,921,114 C167Y probably damaging Het
Trappc9 A T 15: 72,736,869 L897* probably null Het
Trim36 A G 18: 46,169,428 F518L probably benign Het
Ttc12 T G 9: 49,447,967 T402P possibly damaging Het
Twnk T C 19: 45,010,161 V506A possibly damaging Het
Vmn2r18 A T 5: 151,562,217 L604* probably null Het
Wdr83 T C 8: 85,079,831 N113D possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGAAGTATAGGGTCCTTCCTTCC -3'
(R):5'- CACAGCTTGTCAGGTTTCTCAC -3'

Sequencing Primer
(F):5'- AAGTATAGGGTCCTTCCTTCCTACTC -3'
(R):5'- TTTCTCACCAAGGGCGTG -3'
Posted On2019-09-13