Mutagenetix > Incidental Mutation

Incidental Mutation 'R7349:Scel'

570454

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7349 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103543879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 154 (A154T)

Ref Sequence

ENSEMBL: ENSMUSP00000093233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably benign
Transcript: ENSMUST00000095576
AA Change: A154T

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: A154T

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227322
AA Change: A154T

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	T	A	13: 60,842,903	T326S	possibly damaging	Het
Acly	A	T	11: 100,521,991	H91Q	probably benign	Het
Acpp	T	A	9: 104,291,458	I403F	probably benign	Het
Angpt2	T	A	8: 18,692,074	M489L	probably damaging	Het
Arap1	T	C	7: 101,390,228	I565T	possibly damaging	Het
Atg16l2	T	C	7: 101,290,266	D563G	probably damaging	Het
Atp6v0a2	T	A	5: 124,712,328	Y386*	probably null	Het
Atp8b4	A	G	2: 126,325,345	V1078A	probably benign	Het
BC100530	A	G	16: 36,364,312	V23A	probably damaging	Het
Bsn	T	C	9: 108,110,783	D2590G	unknown	Het
Casp12	T	C	9: 5,345,527		probably null	Het
Ccdc87	T	C	19: 4,841,840	S787P	probably damaging	Het
Cdh13	A	G	8: 119,242,358	T485A	probably damaging	Het
Dip2a	T	C	10: 76,285,592	H810R	probably damaging	Het
Dmbt1	A	T	7: 131,041,124	Y120F	unknown	Het
Dmgdh	C	T	13: 93,752,233	T793I	possibly damaging	Het
Dnhd1	A	G	7: 105,710,123	D3555G	probably damaging	Het
Eif4e1b	T	C	13: 54,784,193	V30A	probably benign	Het
Ercc5	T	G	1: 44,180,908	D1113E	possibly damaging	Het
Fbn1	T	C	2: 125,315,401	N2321D	possibly damaging	Het
Fbrs	T	C	7: 127,482,799	L237P	probably damaging	Het
Flg2	T	A	3: 93,220,206	S2142T	unknown	Het
Ftsj3	G	A	11: 106,249,746	T761I	probably damaging	Het
Gdi2	C	A	13: 3,556,395	T157N	probably benign	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gtpbp10	T	C	5: 5,555,379	E108G	possibly damaging	Het
Hectd4	T	C	5: 121,310,663	L358P	probably damaging	Het
Herc3	T	C	6: 58,858,986	C271R	probably benign	Het
Hspb1	C	T	5: 135,889,333	T178M	possibly damaging	Het
Htr3b	C	T	9: 48,936,019	V399M	probably benign	Het
Hydin	A	G	8: 110,398,171		probably null	Het
Itpr3	T	A	17: 27,107,812		probably null	Het
Iyd	G	T	10: 3,545,638	V99F	possibly damaging	Het
Lrrc36	G	A	8: 105,452,268	G365D	probably damaging	Het
Map1b	T	A	13: 99,433,640	I858F	unknown	Het
Med12l	A	T	3: 59,258,325	D1488V	probably damaging	Het
Ms4a6c	T	A	19: 11,478,191	N121K	probably damaging	Het
Nlrp1b	T	G	11: 71,182,117	Q300P	probably benign	Het
Nlrp3	G	A	11: 59,548,086	R163H	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Olfr1411	T	C	1: 92,597,182	V221A	possibly damaging	Het
Olfr652	A	G	7: 104,564,650	H143R	probably benign	Het
Optc	T	G	1: 133,897,879	D356A	probably damaging	Het
Pdzd2	C	G	15: 12,399,205	V812L	probably damaging	Het
Phlpp2	T	C	8: 109,928,646	F691S	probably damaging	Het
Pigk	T	C	3: 152,747,601	F319L	probably benign	Het
Pkhd1l1	A	G	15: 44,514,954	T1035A	probably damaging	Het
Plekhg3	A	G	12: 76,564,565	T261A	probably benign	Het
Plekhm1	A	G	11: 103,387,334	F312S	probably damaging	Het
Pms2	T	A	5: 143,925,836	I587N	probably benign	Het
Ppl	T	A	16: 5,104,729	H272L	probably damaging	Het
Prkce	G	A	17: 86,493,355	A400T	probably benign	Het
Ptpn9	T	C	9: 57,044,376	S324P	probably benign	Het
Ptprk	A	T	10: 28,592,838	N1432I	possibly damaging	Het
R3hdm2	T	C	10: 127,492,646	S746P	probably benign	Het
Rnf220	G	A	4: 117,277,818	A412V	probably damaging	Het
Sirpb1a	A	T	3: 15,410,604	N290K	probably damaging	Het
Sirpb1c	A	T	3: 15,832,146		probably null	Het
Sorbs2	A	T	8: 45,795,823	R704*	probably null	Het
Spast	T	C	17: 74,373,324	V427A	probably damaging	Het
Stxbp4	A	T	11: 90,592,111		probably null	Het
Thsd7a	C	A	6: 12,352,068	G1043C		Het
Tmem205	C	T	9: 21,921,114	C167Y	probably damaging	Het
Trappc9	A	T	15: 72,736,869	L897*	probably null	Het
Trim36	A	G	18: 46,169,428	F518L	probably benign	Het
Ttc12	T	G	9: 49,447,967	T402P	possibly damaging	Het
Twnk	T	C	19: 45,010,161	V506A	possibly damaging	Het
Vmn2r18	A	T	5: 151,562,217	L604*	probably null	Het
Wdr83	T	C	8: 85,079,831	N113D	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TGAAGTATAGGGTCCTTCCTTCC -3'
(R):5'- CACAGCTTGTCAGGTTTCTCAC -3'

Sequencing Primer
(F):5'- AAGTATAGGGTCCTTCCTTCCTACTC -3'
(R):5'- TTTCTCACCAAGGGCGTG -3'

Posted On

2019-09-13