Mutagenetix > Incidental Mutations

Incidental Mutation 'R7349:Ppl'

570458

Institutional Source

Beutler Lab

Gene Symbol

Ppl

Ensembl Gene

ENSMUSG00000039457

Gene Name

periplakin

Synonyms

Accession Numbers

Genbank: NM_008909

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7349 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5086291-5132421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 5104729 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 272 (H272L)

Ref Sequence

ENSEMBL: ENSMUSP00000039360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035672]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035672
AA Change: H272L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: H272L

Domain	Start	End	E-Value	Type
SPEC	123	211	1.58e0	SMART
SPEC	214	315	3.38e-2	SMART
SPEC	321	483	1.11e-2	SMART
SPEC	503	610	4.96e0	SMART
Blast:SPEC	613	717	5e-59	BLAST
low complexity region	718	729	N/A	INTRINSIC
Blast:SPEC	732	859	2e-60	BLAST
low complexity region	893	908	N/A	INTRINSIC
low complexity region	963	982	N/A	INTRINSIC
internal_repeat_2	984	1004	3.46e-5	PROSPERO
internal_repeat_1	992	1008	8.09e-7	PROSPERO
low complexity region	1011	1020	N/A	INTRINSIC
low complexity region	1027	1042	N/A	INTRINSIC
internal_repeat_1	1112	1128	8.09e-7	PROSPERO
coiled coil region	1180	1279	N/A	INTRINSIC
low complexity region	1346	1355	N/A	INTRINSIC
low complexity region	1386	1433	N/A	INTRINSIC
low complexity region	1455	1479	N/A	INTRINSIC
Blast:SPEC	1529	1610	8e-30	BLAST
low complexity region	1612	1630	N/A	INTRINSIC
PLEC	1649	1683	1.34e-5	SMART
PLEC	1698	1733	2.23e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	T	A	13: 60,842,903	T326S	possibly damaging	Het
Acly	A	T	11: 100,521,991	H91Q	probably benign	Het
Acpp	T	A	9: 104,291,458	I403F	probably benign	Het
Angpt2	T	A	8: 18,692,074	M489L	probably damaging	Het
Arap1	T	C	7: 101,390,228	I565T	possibly damaging	Het
Atg16l2	T	C	7: 101,290,266	D563G	probably damaging	Het
Atp6v0a2	T	A	5: 124,712,328	Y386*	probably null	Het
Atp8b4	A	G	2: 126,325,345	V1078A	probably benign	Het
BC100530	A	G	16: 36,364,312	V23A	probably damaging	Het
Bsn	T	C	9: 108,110,783	D2590G	unknown	Het
Casp12	T	C	9: 5,345,527		probably null	Het
Ccdc87	T	C	19: 4,841,840	S787P	probably damaging	Het
Cdh13	A	G	8: 119,242,358	T485A	probably damaging	Het
Dip2a	T	C	10: 76,285,592	H810R	probably damaging	Het
Dmbt1	A	T	7: 131,041,124	Y120F	unknown	Het
Dmgdh	C	T	13: 93,752,233	T793I	possibly damaging	Het
Dnhd1	A	G	7: 105,710,123	D3555G	probably damaging	Het
Eif4e1b	T	C	13: 54,784,193	V30A	probably benign	Het
Ercc5	T	G	1: 44,180,908	D1113E	possibly damaging	Het
Fbn1	T	C	2: 125,315,401	N2321D	possibly damaging	Het
Fbrs	T	C	7: 127,482,799	L237P	probably damaging	Het
Flg2	T	A	3: 93,220,206	S2142T	unknown	Het
Ftsj3	G	A	11: 106,249,746	T761I	probably damaging	Het
Gdi2	C	A	13: 3,556,395	T157N	probably benign	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gtpbp10	T	C	5: 5,555,379	E108G	possibly damaging	Het
Hectd4	T	C	5: 121,310,663	L358P	probably damaging	Het
Herc3	T	C	6: 58,858,986	C271R	probably benign	Het
Hspb1	C	T	5: 135,889,333	T178M	possibly damaging	Het
Htr3b	C	T	9: 48,936,019	V399M	probably benign	Het
Hydin	A	G	8: 110,398,171		probably null	Het
Itpr3	T	A	17: 27,107,812		probably null	Het
Iyd	G	T	10: 3,545,638	V99F	possibly damaging	Het
Lrrc36	G	A	8: 105,452,268	G365D	probably damaging	Het
Map1b	T	A	13: 99,433,640	I858F	unknown	Het
Med12l	A	T	3: 59,258,325	D1488V	probably damaging	Het
Ms4a6c	T	A	19: 11,478,191	N121K	probably damaging	Het
Nlrp1b	T	G	11: 71,182,117	Q300P	probably benign	Het
Nlrp3	G	A	11: 59,548,086	R163H	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Olfr1411	T	C	1: 92,597,182	V221A	possibly damaging	Het
Olfr652	A	G	7: 104,564,650	H143R	probably benign	Het
Optc	T	G	1: 133,897,879	D356A	probably damaging	Het
Pdzd2	C	G	15: 12,399,205	V812L	probably damaging	Het
Phlpp2	T	C	8: 109,928,646	F691S	probably damaging	Het
Pigk	T	C	3: 152,747,601	F319L	probably benign	Het
Pkhd1l1	A	G	15: 44,514,954	T1035A	probably damaging	Het
Plekhg3	A	G	12: 76,564,565	T261A	probably benign	Het
Plekhm1	A	G	11: 103,387,334	F312S	probably damaging	Het
Pms2	T	A	5: 143,925,836	I587N	probably benign	Het
Prkce	G	A	17: 86,493,355	A400T	probably benign	Het
Ptpn9	T	C	9: 57,044,376	S324P	probably benign	Het
Ptprk	A	T	10: 28,592,838	N1432I	possibly damaging	Het
R3hdm2	T	C	10: 127,492,646	S746P	probably benign	Het
Rnf220	G	A	4: 117,277,818	A412V	probably damaging	Het
Scel	G	A	14: 103,543,879	A154T	probably benign	Het
Sirpb1a	A	T	3: 15,410,604	N290K	probably damaging	Het
Sirpb1c	A	T	3: 15,832,146		probably null	Het
Sorbs2	A	T	8: 45,795,823	R704*	probably null	Het
Spast	T	C	17: 74,373,324	V427A	probably damaging	Het
Stxbp4	A	T	11: 90,592,111		probably null	Het
Thsd7a	C	A	6: 12,352,068	G1043C		Het
Tmem205	C	T	9: 21,921,114	C167Y	probably damaging	Het
Trappc9	A	T	15: 72,736,869	L897*	probably null	Het
Trim36	A	G	18: 46,169,428	F518L	probably benign	Het
Ttc12	T	G	9: 49,447,967	T402P	possibly damaging	Het
Twnk	T	C	19: 45,010,161	V506A	possibly damaging	Het
Vmn2r18	A	T	5: 151,562,217	L604*	probably null	Het
Wdr83	T	C	8: 85,079,831	N113D	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Ppl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ppl	APN	16	5089545	missense	probably benign	0.41
IGL00484:Ppl	APN	16	5087952	missense	probably benign	0.13
IGL00654:Ppl	APN	16	5087308	missense	possibly damaging	0.94
IGL00832:Ppl	APN	16	5088975	missense	probably damaging	1.00
IGL01104:Ppl	APN	16	5094491	missense	probably benign	0.01
IGL01327:Ppl	APN	16	5087644	missense	probably benign	0.19
IGL01644:Ppl	APN	16	5091855	missense	probably damaging	1.00
IGL01824:Ppl	APN	16	5087889	missense	probably damaging	1.00
IGL02071:Ppl	APN	16	5113072	missense	probably benign	0.04
IGL02085:Ppl	APN	16	5089816	missense	probably benign	0.09
IGL02282:Ppl	APN	16	5101458	missense	probably damaging	1.00
IGL02635:Ppl	APN	16	5089767	missense	probably benign	0.01
IGL02649:Ppl	APN	16	5087463	missense	probably damaging	1.00
IGL02888:Ppl	APN	16	5100407	missense	possibly damaging	0.89
IGL03305:Ppl	APN	16	5093233	missense	possibly damaging	0.62
G4846:Ppl	UTSW	16	5087206	missense	probably damaging	1.00
IGL03097:Ppl	UTSW	16	5096726	missense	probably damaging	0.98
R0759:Ppl	UTSW	16	5089777	missense	probably benign	0.00
R0786:Ppl	UTSW	16	5089054	missense	probably damaging	1.00
R1024:Ppl	UTSW	16	5100000	missense	probably damaging	1.00
R1498:Ppl	UTSW	16	5104765	missense	probably benign	0.05
R1544:Ppl	UTSW	16	5102597	nonsense	probably null
R1597:Ppl	UTSW	16	5107574	missense	probably benign	0.20
R1863:Ppl	UTSW	16	5087980	missense	possibly damaging	0.69
R1921:Ppl	UTSW	16	5106124	missense	possibly damaging	0.80
R2230:Ppl	UTSW	16	5088981	missense	possibly damaging	0.51
R2275:Ppl	UTSW	16	5094552	missense	probably benign	0.00
R2355:Ppl	UTSW	16	5094497	missense	probably benign	0.00
R3410:Ppl	UTSW	16	5107517	missense	possibly damaging	0.81
R3737:Ppl	UTSW	16	5106857	missense	probably benign
R3797:Ppl	UTSW	16	5104550	splice site	probably benign
R3968:Ppl	UTSW	16	5100332	splice site	probably null
R3970:Ppl	UTSW	16	5100332	splice site	probably null
R4034:Ppl	UTSW	16	5106857	missense	probably benign
R4583:Ppl	UTSW	16	5104536	missense	probably benign	0.02
R4639:Ppl	UTSW	16	5089446	missense	probably damaging	1.00
R4762:Ppl	UTSW	16	5088982	missense	probably benign	0.00
R4828:Ppl	UTSW	16	5104926	missense	probably damaging	1.00
R4869:Ppl	UTSW	16	5104889	missense	probably damaging	0.99
R4925:Ppl	UTSW	16	5104982	missense	probably damaging	1.00
R4983:Ppl	UTSW	16	5088718	missense	possibly damaging	0.75
R4984:Ppl	UTSW	16	5087641	missense	probably benign
R4997:Ppl	UTSW	16	5089371	missense	probably damaging	1.00
R5072:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5073:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5074:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5286:Ppl	UTSW	16	5089123	nonsense	probably null
R5398:Ppl	UTSW	16	5104922	missense	probably benign	0.00
R5448:Ppl	UTSW	16	5107566	missense	probably benign
R5664:Ppl	UTSW	16	5106055	missense	probably benign	0.00
R5873:Ppl	UTSW	16	5106049	critical splice donor site	probably null
R5918:Ppl	UTSW	16	5104901	missense	probably benign	0.00
R5951:Ppl	UTSW	16	5088628	missense	probably benign	0.25
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6088:Ppl	UTSW	16	5104988	missense	possibly damaging	0.73
R6149:Ppl	UTSW	16	5107596	nonsense	probably null
R6358:Ppl	UTSW	16	5087929	nonsense	probably null
R6379:Ppl	UTSW	16	5097691	missense	probably benign	0.02
R6468:Ppl	UTSW	16	5092441	missense	probably damaging	1.00
R6514:Ppl	UTSW	16	5087317	missense	probably damaging	1.00
R6528:Ppl	UTSW	16	5087616	missense	probably benign	0.00
R6703:Ppl	UTSW	16	5089464	missense	probably damaging	0.99
R6721:Ppl	UTSW	16	5107469	missense	probably damaging	0.97
R6811:Ppl	UTSW	16	5089144	missense	probably damaging	0.99
R6934:Ppl	UTSW	16	5094509	missense	probably benign	0.00
R7034:Ppl	UTSW	16	5087502	missense	probably benign	0.29
R7076:Ppl	UTSW	16	5100119	missense	probably damaging	1.00
R7300:Ppl	UTSW	16	5102371	missense	possibly damaging	0.87
R7359:Ppl	UTSW	16	5089341	missense	possibly damaging	0.78
R7378:Ppl	UTSW	16	5112996	missense	possibly damaging	0.91
R7383:Ppl	UTSW	16	5097971	missense	probably damaging	1.00
R7389:Ppl	UTSW	16	5106713	intron	probably null
R7445:Ppl	UTSW	16	5089068	missense	probably damaging	1.00
R7687:Ppl	UTSW	16	5097942	missense	probably benign	0.00
R7752:Ppl	UTSW	16	5102302	missense	probably benign	0.09
R7827:Ppl	UTSW	16	5087964	missense	probably damaging	1.00
RF009:Ppl	UTSW	16	5097931	missense	probably benign	0.00
X0054:Ppl	UTSW	16	5104902	missense	probably benign	0.00
Z1088:Ppl	UTSW	16	5089507	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGCAGGTTCAGGTACTCCTTC -3'
(R):5'- TGCAGTATGACTGGAGCGAC -3'

Sequencing Primer
(F):5'- ATGCACAGCCTCCATGTGTG -3'
(R):5'- TATGACTGGAGCGACCGCAAC -3'

Posted On

2019-09-13