Incidental Mutation 'R7350:F5'
ID 570469
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Name coagulation factor V
Synonyms Cf-5, Cf5
MMRRC Submission 045436-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 163979407-164047846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 164020277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 917 (K917N)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
AlphaFold O88783
Predicted Effect probably benign
Transcript: ENSMUST00000086040
AA Change: K917N

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: K917N

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 T C 7: 132,476,578 (GRCm39) F106S probably damaging Het
Acsf3 A G 8: 123,512,685 (GRCm39) T369A probably benign Het
Adgrf5 G A 17: 43,739,335 (GRCm39) probably null Het
Aff1 T A 5: 103,994,958 (GRCm39) I1052K probably benign Het
Akap8 T C 17: 32,535,549 (GRCm39) D155G possibly damaging Het
Alg10b A T 15: 90,111,653 (GRCm39) M166L probably benign Het
Allc T A 12: 28,613,408 (GRCm39) Q178L possibly damaging Het
Angptl4 C A 17: 33,996,084 (GRCm39) L297F probably damaging Het
Arfgap1 A G 2: 180,612,869 (GRCm39) K8E possibly damaging Het
Bckdhb T A 9: 83,892,379 (GRCm39) V270E possibly damaging Het
Cbx3 T C 6: 51,452,355 (GRCm39) probably null Het
Cd44 G T 2: 102,664,607 (GRCm39) N531K probably benign Het
Cdh23 A T 10: 60,246,689 (GRCm39) D916E probably damaging Het
Cr2 A G 1: 194,837,594 (GRCm39) V792A probably benign Het
Cstf3 T C 2: 104,439,301 (GRCm39) L38P probably damaging Het
Cyp2a5 A G 7: 26,536,208 (GRCm39) E151G probably benign Het
Dbr1 T C 9: 99,464,602 (GRCm39) F127S Het
Ddit4 A T 10: 59,787,317 (GRCm39) D6E probably damaging Het
Disc1 G C 8: 125,891,841 (GRCm39) R631S probably damaging Het
Dnah5 T A 15: 28,235,965 (GRCm39) probably null Het
Dnah9 T C 11: 65,971,404 (GRCm39) K1595E probably damaging Het
Dnmbp T C 19: 43,889,944 (GRCm39) R608G probably damaging Het
Efcab5 G C 11: 77,028,387 (GRCm39) P315A probably benign Het
Eif4a2 A G 16: 22,932,012 (GRCm39) Y392C possibly damaging Het
Fig4 T C 10: 41,127,752 (GRCm39) M571V probably benign Het
Flot2 T A 11: 77,948,802 (GRCm39) I259N probably damaging Het
Gm8122 C A 14: 43,088,058 (GRCm39) probably null Het
Gpr152 T C 19: 4,192,963 (GRCm39) V168A possibly damaging Het
H1f0 G A 15: 78,913,103 (GRCm39) G61D probably damaging Het
Ihh T A 1: 74,987,492 (GRCm39) K183M probably damaging Het
Itga2 A G 13: 114,973,738 (GRCm39) L1116P probably damaging Het
Kcnj10 A G 1: 172,196,827 (GRCm39) T114A possibly damaging Het
Kcnk3 T G 5: 30,779,310 (GRCm39) L120R probably damaging Het
Krt14 C A 11: 100,095,926 (GRCm39) E211* probably null Het
Lars2 T C 9: 123,256,545 (GRCm39) L350P probably damaging Het
Lrba T C 3: 86,259,209 (GRCm39) I1408T probably damaging Het
Lrrc27 A G 7: 138,806,022 (GRCm39) E229G probably benign Het
Lrrc8e G T 8: 4,285,626 (GRCm39) R617L probably benign Het
M1ap A G 6: 82,958,930 (GRCm39) D187G probably benign Het
Marchf1 A T 8: 66,921,051 (GRCm39) K243* probably null Het
Med16 C T 10: 79,739,031 (GRCm39) V252M probably damaging Het
Micu3 T C 8: 40,801,999 (GRCm39) S189P probably benign Het
Mier2 C A 10: 79,376,132 (GRCm39) M264I unknown Het
Mindy4 A T 6: 55,278,010 (GRCm39) N618I probably damaging Het
Mmrn1 C T 6: 60,953,320 (GRCm39) Q534* probably null Het
Mroh9 C T 1: 162,903,858 (GRCm39) probably null Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Mta3 T A 17: 84,015,870 (GRCm39) I24N probably damaging Het
Mtmr4 A T 11: 87,491,476 (GRCm39) H147L probably damaging Het
Nfam1 T C 15: 82,894,640 (GRCm39) K155R probably benign Het
Nlrp6 A T 7: 140,501,191 (GRCm39) probably benign Het
Or1q1 T A 2: 36,886,873 (GRCm39) I17N possibly damaging Het
Or5d37 A T 2: 87,923,542 (GRCm39) F246Y probably benign Het
Or5w20 T C 2: 87,726,753 (GRCm39) probably benign Het
Or6d13 A G 6: 116,517,495 (GRCm39) E27G probably benign Het
Or9g4 A G 2: 85,505,189 (GRCm39) F102S Het
P4ha1 A G 10: 59,186,240 (GRCm39) R240G probably damaging Het
Pla2r1 G T 2: 60,288,723 (GRCm39) D636E probably benign Het
Polr2a A G 11: 69,631,886 (GRCm39) L1060P possibly damaging Het
Prr35 A T 17: 26,165,685 (GRCm39) V534D probably damaging Het
Ptgdr2 C A 19: 10,918,319 (GRCm39) Q279K probably benign Het
Rab11fip2 T A 19: 59,925,853 (GRCm39) R121S probably benign Het
Rasa2 T C 9: 96,426,408 (GRCm39) S813G probably benign Het
Rassf5 T C 1: 131,106,273 (GRCm39) K411E possibly damaging Het
Reep4 T C 14: 70,783,987 (GRCm39) Y35H probably damaging Het
Ror1 A T 4: 100,283,140 (GRCm39) M402L probably benign Het
Slc32a1 A G 2: 158,456,326 (GRCm39) E327G probably damaging Het
Spen C T 4: 141,206,696 (GRCm39) E644K unknown Het
Tars3 C G 7: 65,308,672 (GRCm39) Q281E probably damaging Het
Tcl1 A G 12: 105,184,934 (GRCm39) I92T probably damaging Het
Tifab A G 13: 56,324,120 (GRCm39) S108P probably damaging Het
Traf1 T C 2: 34,838,245 (GRCm39) N198D probably benign Het
Trim35 T C 14: 66,546,654 (GRCm39) Y474H probably damaging Het
Trim54 T A 5: 31,294,505 (GRCm39) D344E probably benign Het
Ttc28 A T 5: 111,373,903 (GRCm39) H1113L probably damaging Het
Vcam1 T A 3: 115,908,211 (GRCm39) D617V probably damaging Het
Vmn2r81 A T 10: 79,104,219 (GRCm39) T281S probably benign Het
Whrn C T 4: 63,350,196 (GRCm39) R507K possibly damaging Het
Zdhhc14 A G 17: 5,777,151 (GRCm39) S303G probably benign Het
Zfp292 A T 4: 34,806,839 (GRCm39) N2073K probably benign Het
Zgpat T A 2: 181,022,228 (GRCm39) V163D Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164,007,093 (GRCm39) missense probably benign 0.15
IGL00843:F5 APN 1 164,039,360 (GRCm39) missense probably benign 0.00
IGL00904:F5 APN 1 164,021,578 (GRCm39) missense probably benign
IGL00913:F5 APN 1 164,032,465 (GRCm39) missense probably damaging 1.00
IGL01099:F5 APN 1 164,021,903 (GRCm39) missense probably damaging 0.99
IGL01134:F5 APN 1 164,019,548 (GRCm39) missense possibly damaging 0.87
IGL01313:F5 APN 1 164,021,181 (GRCm39) missense probably benign 0.01
IGL01635:F5 APN 1 164,035,427 (GRCm39) missense probably benign 0.00
IGL01697:F5 APN 1 164,021,621 (GRCm39) missense probably benign 0.04
IGL01768:F5 APN 1 164,003,914 (GRCm39) missense probably benign 0.22
IGL01795:F5 APN 1 164,021,959 (GRCm39) missense probably benign 0.00
IGL01835:F5 APN 1 164,021,937 (GRCm39) missense probably benign 0.12
IGL01843:F5 APN 1 164,039,395 (GRCm39) missense probably benign 0.05
IGL01989:F5 APN 1 164,003,876 (GRCm39) missense probably benign 0.39
IGL02036:F5 APN 1 164,010,571 (GRCm39) splice site probably benign
IGL02065:F5 APN 1 164,017,695 (GRCm39) missense probably damaging 1.00
IGL02077:F5 APN 1 164,026,435 (GRCm39) missense probably damaging 1.00
IGL02139:F5 APN 1 164,020,243 (GRCm39) missense possibly damaging 0.89
IGL02210:F5 APN 1 164,017,710 (GRCm39) missense probably benign 0.00
IGL02415:F5 APN 1 164,019,498 (GRCm39) missense probably damaging 1.00
IGL02440:F5 APN 1 164,034,635 (GRCm39) missense possibly damaging 0.79
IGL02471:F5 APN 1 164,001,860 (GRCm39) missense probably damaging 1.00
IGL02535:F5 APN 1 164,026,302 (GRCm39) missense probably damaging 0.98
IGL02537:F5 APN 1 164,020,686 (GRCm39) missense probably benign 0.26
IGL02628:F5 APN 1 164,021,644 (GRCm39) missense probably damaging 0.99
IGL02638:F5 APN 1 164,012,177 (GRCm39) critical splice donor site probably null
IGL02824:F5 APN 1 164,021,916 (GRCm39) missense probably benign 0.00
IGL02977:F5 APN 1 164,021,590 (GRCm39) missense probably damaging 1.00
IGL03028:F5 APN 1 164,020,569 (GRCm39) nonsense probably null
IGL03064:F5 APN 1 164,023,163 (GRCm39) missense probably benign 0.04
IGL03127:F5 APN 1 164,021,107 (GRCm39) missense probably benign 0.45
IGL03131:F5 APN 1 163,989,388 (GRCm39) missense possibly damaging 0.62
IGL03348:F5 APN 1 164,021,721 (GRCm39) missense possibly damaging 0.49
IGL03387:F5 APN 1 164,020,801 (GRCm39) missense probably damaging 1.00
James_dean UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
BB002:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
BB012:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R0002:F5 UTSW 1 164,029,200 (GRCm39) missense probably damaging 1.00
R0095:F5 UTSW 1 164,019,537 (GRCm39) nonsense probably null
R0116:F5 UTSW 1 164,012,483 (GRCm39) missense probably benign 0.01
R0359:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0426:F5 UTSW 1 164,010,409 (GRCm39) missense probably damaging 0.99
R0452:F5 UTSW 1 164,012,676 (GRCm39) missense probably damaging 0.99
R0457:F5 UTSW 1 164,021,769 (GRCm39) missense probably benign 0.00
R0520:F5 UTSW 1 164,037,156 (GRCm39) missense probably benign 0.15
R0522:F5 UTSW 1 164,039,332 (GRCm39) missense probably damaging 1.00
R0554:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0575:F5 UTSW 1 164,003,813 (GRCm39) missense probably damaging 1.00
R0734:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R0739:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1062:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1063:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1150:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1151:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1152:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1221:F5 UTSW 1 163,989,368 (GRCm39) missense probably damaging 1.00
R1284:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1286:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1358:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1360:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1362:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1383:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1545:F5 UTSW 1 164,036,529 (GRCm39) nonsense probably null
R1561:F5 UTSW 1 164,014,472 (GRCm39) nonsense probably null
R1623:F5 UTSW 1 164,023,191 (GRCm39) missense probably damaging 1.00
R1662:F5 UTSW 1 164,035,457 (GRCm39) missense probably damaging 1.00
R1673:F5 UTSW 1 164,007,089 (GRCm39) missense probably damaging 1.00
R1689:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1705:F5 UTSW 1 164,045,059 (GRCm39) missense possibly damaging 0.92
R1732:F5 UTSW 1 164,001,719 (GRCm39) missense probably damaging 1.00
R1763:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1774:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1799:F5 UTSW 1 164,021,100 (GRCm39) missense possibly damaging 0.58
R1800:F5 UTSW 1 164,010,403 (GRCm39) missense probably damaging 1.00
R1842:F5 UTSW 1 164,012,129 (GRCm39) missense probably damaging 0.99
R1915:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R1926:F5 UTSW 1 164,007,077 (GRCm39) missense probably damaging 1.00
R2025:F5 UTSW 1 164,037,044 (GRCm39) missense probably benign 0.05
R2198:F5 UTSW 1 164,034,603 (GRCm39) missense probably damaging 1.00
R2258:F5 UTSW 1 164,019,750 (GRCm39) missense probably damaging 1.00
R2264:F5 UTSW 1 164,021,971 (GRCm39) missense probably benign 0.32
R2281:F5 UTSW 1 164,023,289 (GRCm39) missense possibly damaging 0.80
R2407:F5 UTSW 1 164,039,441 (GRCm39) missense probably damaging 1.00
R2445:F5 UTSW 1 164,017,795 (GRCm39) missense probably damaging 1.00
R2860:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2861:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2862:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2899:F5 UTSW 1 164,014,469 (GRCm39) missense possibly damaging 0.88
R2910:F5 UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
R2912:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R2996:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R3745:F5 UTSW 1 164,014,348 (GRCm39) missense possibly damaging 0.79
R3901:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R3902:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R4365:F5 UTSW 1 164,012,519 (GRCm39) missense probably damaging 0.98
R4448:F5 UTSW 1 164,026,468 (GRCm39) missense possibly damaging 0.52
R4490:F5 UTSW 1 164,044,964 (GRCm39) missense probably benign 0.40
R4514:F5 UTSW 1 163,979,566 (GRCm39) unclassified probably benign
R4598:F5 UTSW 1 164,032,366 (GRCm39) missense probably benign 0.05
R4608:F5 UTSW 1 164,036,598 (GRCm39) missense probably benign 0.12
R4661:F5 UTSW 1 164,012,489 (GRCm39) missense probably damaging 1.00
R4667:F5 UTSW 1 164,001,755 (GRCm39) missense probably benign 0.00
R4689:F5 UTSW 1 163,979,542 (GRCm39) unclassified probably benign
R4716:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R4732:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4733:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4854:F5 UTSW 1 164,019,715 (GRCm39) missense probably damaging 1.00
R4908:F5 UTSW 1 164,039,389 (GRCm39) missense probably damaging 1.00
R4971:F5 UTSW 1 164,021,755 (GRCm39) missense probably benign
R5001:F5 UTSW 1 164,023,139 (GRCm39) missense probably benign 0.00
R5042:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R5056:F5 UTSW 1 164,019,601 (GRCm39) missense possibly damaging 0.60
R5061:F5 UTSW 1 164,021,749 (GRCm39) missense probably benign 0.00
R5143:F5 UTSW 1 164,039,397 (GRCm39) missense probably damaging 0.98
R5622:F5 UTSW 1 164,020,134 (GRCm39) missense probably benign 0.09
R5626:F5 UTSW 1 164,036,604 (GRCm39) missense probably damaging 0.98
R5658:F5 UTSW 1 164,019,907 (GRCm39) missense probably damaging 0.96
R5702:F5 UTSW 1 164,022,116 (GRCm39) nonsense probably null
R5795:F5 UTSW 1 163,979,578 (GRCm39) missense probably benign 0.09
R5884:F5 UTSW 1 164,023,215 (GRCm39) missense probably benign 0.01
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6151:F5 UTSW 1 164,009,204 (GRCm39) missense probably damaging 1.00
R6151:F5 UTSW 1 164,017,756 (GRCm39) missense probably damaging 1.00
R6345:F5 UTSW 1 164,019,520 (GRCm39) missense probably benign 0.13
R6391:F5 UTSW 1 164,021,062 (GRCm39) missense probably damaging 0.99
R6542:F5 UTSW 1 164,022,037 (GRCm39) missense probably benign 0.32
R6620:F5 UTSW 1 164,014,375 (GRCm39) missense probably damaging 1.00
R6750:F5 UTSW 1 164,021,076 (GRCm39) missense possibly damaging 0.58
R6754:F5 UTSW 1 164,021,332 (GRCm39) missense probably damaging 1.00
R6774:F5 UTSW 1 164,014,447 (GRCm39) missense probably damaging 1.00
R6802:F5 UTSW 1 164,006,925 (GRCm39) missense probably damaging 0.98
R6810:F5 UTSW 1 164,014,471 (GRCm39) missense probably damaging 1.00
R6983:F5 UTSW 1 164,021,698 (GRCm39) missense probably damaging 1.00
R7000:F5 UTSW 1 164,007,075 (GRCm39) missense probably damaging 1.00
R7151:F5 UTSW 1 164,029,230 (GRCm39) missense probably damaging 1.00
R7193:F5 UTSW 1 164,046,966 (GRCm39) missense probably damaging 1.00
R7230:F5 UTSW 1 164,012,522 (GRCm39) missense probably benign
R7324:F5 UTSW 1 164,021,150 (GRCm39) small deletion probably benign
R7466:F5 UTSW 1 164,020,897 (GRCm39) missense possibly damaging 0.61
R7503:F5 UTSW 1 164,019,779 (GRCm39) missense probably damaging 1.00
R7626:F5 UTSW 1 164,014,481 (GRCm39) missense possibly damaging 0.95
R7742:F5 UTSW 1 164,035,453 (GRCm39) missense possibly damaging 0.51
R7837:F5 UTSW 1 164,014,363 (GRCm39) missense probably damaging 1.00
R7848:F5 UTSW 1 163,989,446 (GRCm39) missense possibly damaging 0.94
R7925:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R8053:F5 UTSW 1 164,020,338 (GRCm39) missense probably benign 0.26
R8094:F5 UTSW 1 164,036,509 (GRCm39) missense probably benign 0.06
R8175:F5 UTSW 1 164,019,834 (GRCm39) nonsense probably null
R8209:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8226:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8266:F5 UTSW 1 164,012,693 (GRCm39) critical splice donor site probably null
R8517:F5 UTSW 1 164,003,822 (GRCm39) missense probably damaging 0.99
R8684:F5 UTSW 1 164,045,111 (GRCm39) missense probably benign 0.01
R8941:F5 UTSW 1 164,026,440 (GRCm39) missense probably benign 0.19
R9130:F5 UTSW 1 164,001,830 (GRCm39) missense probably benign 0.37
R9181:F5 UTSW 1 164,019,895 (GRCm39) missense probably benign 0.00
R9186:F5 UTSW 1 164,021,470 (GRCm39) missense probably benign
R9233:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R9314:F5 UTSW 1 164,029,146 (GRCm39) missense probably benign 0.01
R9631:F5 UTSW 1 164,014,423 (GRCm39) missense probably damaging 1.00
R9655:F5 UTSW 1 164,021,730 (GRCm39) missense probably benign 0.15
X0024:F5 UTSW 1 164,020,557 (GRCm39) missense probably damaging 1.00
Z1088:F5 UTSW 1 163,981,954 (GRCm39) missense probably benign 0.04
Z1176:F5 UTSW 1 164,012,085 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCAAAAGGATCTGGGAATCG -3'
(R):5'- CCAGAAAATGTTGGGAGGTCAC -3'

Sequencing Primer
(F):5'- TCTGGGAATCGAGAACAAGATAAACC -3'
(R):5'- AAAATGTTGGGAGGTCACTTGGC -3'
Posted On 2019-09-13