Incidental Mutation 'R7350:Arfgap1'
ID570481
Institutional Source Beutler Lab
Gene Symbol Arfgap1
Ensembl Gene ENSMUSG00000027575
Gene NameADP-ribosylation factor GTPase activating protein 1
SynonymsARF1 GAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location180967225-180982526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180971076 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 8 (K8E)
Ref Sequence ENSEMBL: ENSMUSP00000104490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029092] [ENSMUST00000108859] [ENSMUST00000108860] [ENSMUST00000108861] [ENSMUST00000108862] [ENSMUST00000184394] [ENSMUST00000185115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029092
AA Change: K8E

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029092
Gene: ENSMUSG00000027575
AA Change: K8E

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 310 327 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 359 392 N/A INTRINSIC
low complexity region 394 401 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108859
AA Change: K8E

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104487
Gene: ENSMUSG00000027575
AA Change: K8E

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108860
AA Change: K8E

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104488
Gene: ENSMUSG00000027575
AA Change: K8E

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108861
AA Change: K8E

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104489
Gene: ENSMUSG00000027575
AA Change: K8E

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108862
AA Change: K8E

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104490
Gene: ENSMUSG00000027575
AA Change: K8E

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184394
AA Change: K8E

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138843
Gene: ENSMUSG00000027575
AA Change: K8E

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 298 315 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 347 380 N/A INTRINSIC
low complexity region 382 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185115
AA Change: K8E

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139222
Gene: ENSMUSG00000027575
AA Change: K8E

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 320 337 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
low complexity region 369 402 N/A INTRINSIC
low complexity region 404 411 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein, which associates with the Golgi apparatus and which interacts with ADP-ribosylation factor 1. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1-bound GTP and is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is required for the fusion of these vesicles with target compartments. The activity of this protein is stimulated by phosphoinosides and inhibited by phosphatidylcholine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Arfgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Arfgap1 APN 2 180972725 missense probably benign 0.01
IGL01521:Arfgap1 APN 2 180971578 missense probably damaging 1.00
IGL02118:Arfgap1 APN 2 180980444 missense possibly damaging 0.89
R1858:Arfgap1 UTSW 2 180974088 missense probably damaging 1.00
R2060:Arfgap1 UTSW 2 180972782 missense probably benign
R2509:Arfgap1 UTSW 2 180974053 splice site probably benign
R4423:Arfgap1 UTSW 2 180981076 missense probably benign 0.00
R4424:Arfgap1 UTSW 2 180981076 missense probably benign 0.00
R4425:Arfgap1 UTSW 2 180981076 missense probably benign 0.00
R4569:Arfgap1 UTSW 2 180976373 splice site probably benign
R5668:Arfgap1 UTSW 2 180974119 missense possibly damaging 0.81
R5834:Arfgap1 UTSW 2 180981162 missense probably benign 0.01
R5915:Arfgap1 UTSW 2 180978422 missense possibly damaging 0.88
R6819:Arfgap1 UTSW 2 180971685 critical splice donor site probably null
R7011:Arfgap1 UTSW 2 180972142 missense probably damaging 1.00
R7017:Arfgap1 UTSW 2 180976304 splice site probably null
R7069:Arfgap1 UTSW 2 180974120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCATTGAGAAGAGCCTCCTTG -3'
(R):5'- TCCTTAGCACAACCTGAGCG -3'

Sequencing Primer
(F):5'- AAGAGCCTCCTTGGTAAATGGCTC -3'
(R):5'- ACCTGAGCGATGCAACAG -3'
Posted On2019-09-13