Mutagenetix > Incidental Mutation

Incidental Mutation 'R7350:Lrba'

570483

Institutional Source

Beutler Lab

Gene Symbol

Lrba

Ensembl Gene

ENSMUSG00000028080

Gene Name

LPS-responsive beige-like anchor

Synonyms

Lba, D3Ertd775e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86224680-86782692 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86351902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1408 (I1408T)

Ref Sequence

ENSEMBL: ENSMUSP00000103261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107635
AA Change: I1408T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: I1408T

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	211	377	4.6e-13	PFAM
Pfam:DUF4704	446	717	2.5e-109	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2049	7e-88	PFAM
Pfam:PH_BEACH	2075	2172	9.1e-31	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART
WD40	2760	2798	1.79e-1	SMART
WD40	2801	2840	4.28e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192145
AA Change: I1408T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: I1408T

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	7.4e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.5e-92	PFAM
Pfam:PH_BEACH	2068	2172	7.5e-32	PFAM
Beach	2203	2480	2.87e-207	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194759
AA Change: I1408T

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: I1408T

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	8.1e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.6e-92	PFAM
Pfam:PH_BEACH	2068	2172	8.3e-32	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212390
AA Change: I1408T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	A	T	17: 25,946,711	V534D	probably damaging	Het
Abraxas2	T	C	7: 132,874,849	F106S	probably damaging	Het
Acsf3	A	G	8: 122,785,946	T369A	probably benign	Het
Adgrf5	G	A	17: 43,428,444		probably null	Het
Aff1	T	A	5: 103,847,092	I1052K	probably benign	Het
Akap8	T	C	17: 32,316,575	D155G	possibly damaging	Het
Alg10b	A	T	15: 90,227,450	M166L	probably benign	Het
Allc	T	A	12: 28,563,409	Q178L	possibly damaging	Het
Angptl4	C	A	17: 33,777,110	L297F	probably damaging	Het
Arfgap1	A	G	2: 180,971,076	K8E	possibly damaging	Het
Bckdhb	T	A	9: 84,010,326	V270E	possibly damaging	Het
Cbx3	T	C	6: 51,475,375		probably null	Het
Cd44	G	T	2: 102,834,262	N531K	probably benign	Het
Cdh23	A	T	10: 60,410,910	D916E	probably damaging	Het
Cr2	A	G	1: 195,155,286	V792A	probably benign	Het
Cstf3	T	C	2: 104,608,956	L38P	probably damaging	Het
Cyp2a5	A	G	7: 26,836,783	E151G	probably benign	Het
Dbr1	T	C	9: 99,582,549	F127S		Het
Ddit4	A	T	10: 59,951,495	D6E	probably damaging	Het
Disc1	G	C	8: 125,165,102	R631S	probably damaging	Het
Dnah5	T	A	15: 28,235,819		probably null	Het
Dnah9	T	C	11: 66,080,578	K1595E	probably damaging	Het
Dnmbp	T	C	19: 43,901,505	R608G	probably damaging	Het
Efcab5	G	C	11: 77,137,561	P315A	probably benign	Het
Eif4a2	A	G	16: 23,113,262	Y392C	possibly damaging	Het
F5	G	T	1: 164,192,708	K917N	probably benign	Het
Fig4	T	C	10: 41,251,756	M571V	probably benign	Het
Flot2	T	A	11: 78,057,976	I259N	probably damaging	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gpr152	T	C	19: 4,142,964	V168A	possibly damaging	Het
H1f0	G	A	15: 79,028,903	G61D	probably damaging	Het
Ihh	T	A	1: 74,948,333	K183M	probably damaging	Het
Itga2	A	G	13: 114,837,202	L1116P	probably damaging	Het
Kcnj10	A	G	1: 172,369,260	T114A	possibly damaging	Het
Kcnk3	T	G	5: 30,621,966	L120R	probably damaging	Het
Krt14	C	A	11: 100,205,100	E211*	probably null	Het
Lars2	T	C	9: 123,427,480	L350P	probably damaging	Het
Lrrc27	A	G	7: 139,226,106	E229G	probably benign	Het
Lrrc8e	G	T	8: 4,235,626	R617L	probably benign	Het
M1ap	A	G	6: 82,981,949	D187G	probably benign	Het
March1	A	T	8: 66,468,399	K243*	probably null	Het
Med16	C	T	10: 79,903,197	V252M	probably damaging	Het
Micu3	T	C	8: 40,348,958	S189P	probably benign	Het
Mier2	C	A	10: 79,540,298	M264I	unknown	Het
Mindy4	A	T	6: 55,301,025	N618I	probably damaging	Het
Mmrn1	C	T	6: 60,976,336	Q534*	probably null	Het
Mroh9	C	T	1: 163,076,289		probably null	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Mta3	T	A	17: 83,708,441	I24N	probably damaging	Het
Mtmr4	A	T	11: 87,600,650	H147L	probably damaging	Het
Nfam1	T	C	15: 83,010,439	K155R	probably benign	Het
Nlrp6	A	T	7: 140,921,278		probably benign	Het
Olfr1006	A	G	2: 85,674,845	F102S		Het
Olfr1153	T	C	2: 87,896,409		probably benign	Het
Olfr1164	A	T	2: 88,093,198	F246Y	probably benign	Het
Olfr213	A	G	6: 116,540,534	E27G	probably benign	Het
Olfr357	T	A	2: 36,996,861	I17N	possibly damaging	Het
P4ha1	A	G	10: 59,350,418	R240G	probably damaging	Het
Pla2r1	G	T	2: 60,458,379	D636E	probably benign	Het
Polr2a	A	G	11: 69,741,060	L1060P	possibly damaging	Het
Ptgdr2	C	A	19: 10,940,955	Q279K	probably benign	Het
Rab11fip2	T	A	19: 59,937,421	R121S	probably benign	Het
Rasa2	T	C	9: 96,544,355	S813G	probably benign	Het
Rassf5	T	C	1: 131,178,536	K411E	possibly damaging	Het
Reep4	T	C	14: 70,546,547	Y35H	probably damaging	Het
Ror1	A	T	4: 100,425,943	M402L	probably benign	Het
Slc32a1	A	G	2: 158,614,406	E327G	probably damaging	Het
Spen	C	T	4: 141,479,385	E644K	unknown	Het
Tarsl2	C	G	7: 65,658,924	Q281E	probably damaging	Het
Tcl1	A	G	12: 105,218,675	I92T	probably damaging	Het
Tifab	A	G	13: 56,176,307	S108P	probably damaging	Het
Traf1	T	C	2: 34,948,233	N198D	probably benign	Het
Trim35	T	C	14: 66,309,205	Y474H	probably damaging	Het
Trim54	T	A	5: 31,137,161	D344E	probably benign	Het
Ttc28	A	T	5: 111,226,037	H1113L	probably damaging	Het
Vcam1	T	A	3: 116,114,562	D617V	probably damaging	Het
Vmn2r81	A	T	10: 79,268,385	T281S	probably benign	Het
Whrn	C	T	4: 63,431,959	R507K	possibly damaging	Het
Zdhhc14	A	G	17: 5,726,876	S303G	probably benign	Het
Zfp292	A	T	4: 34,806,839	N2073K	probably benign	Het
Zgpat	T	A	2: 181,380,435	V163D		Het

Other mutations in Lrba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Lrba	APN	3	86359782	missense	probably benign	0.00
IGL00788:Lrba	APN	3	86327685	missense	probably damaging	0.97
IGL01139:Lrba	APN	3	86642662	missense	possibly damaging	0.88
IGL01302:Lrba	APN	3	86295400	missense	probably damaging	1.00
IGL01612:Lrba	APN	3	86776177	missense	possibly damaging	0.89
IGL01718:Lrba	APN	3	86351248	missense	probably damaging	1.00
IGL01719:Lrba	APN	3	86327596	splice site	probably benign
IGL01730:Lrba	APN	3	86741424	missense	possibly damaging	0.89
IGL01735:Lrba	APN	3	86327661	missense	probably benign	0.28
IGL01875:Lrba	APN	3	86310047	missense	probably damaging	1.00
IGL01884:Lrba	APN	3	86310412	missense	possibly damaging	0.86
IGL02264:Lrba	APN	3	86780262	missense	probably damaging	0.99
IGL02638:Lrba	APN	3	86325073	missense	probably damaging	0.97
IGL02647:Lrba	APN	3	86359731	missense	probably benign	0.00
IGL02664:Lrba	APN	3	86325731	missense	possibly damaging	0.84
IGL02728:Lrba	APN	3	86776049	missense	probably damaging	0.99
IGL02730:Lrba	APN	3	86328199	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86354206	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86445413	missense	probably damaging	0.99
IGL02948:Lrba	APN	3	86310384	splice site	probably null
IGL03090:Lrba	APN	3	86773141	missense	probably benign	0.01
molasses	UTSW	3	86354307	critical splice donor site	probably null
oscar	UTSW	3	86350304	nonsense	probably null
oscar2	UTSW	3	86664458	nonsense	probably null
P0023:Lrba	UTSW	3	86417935	missense	probably damaging	1.00
PIT4802001:Lrba	UTSW	3	86664494	nonsense	probably null
R0077:Lrba	UTSW	3	86542688	missense	probably damaging	0.99
R0189:Lrba	UTSW	3	86368509	missense	probably damaging	1.00
R0217:Lrba	UTSW	3	86642722	missense	probably damaging	1.00
R0349:Lrba	UTSW	3	86540005	missense	probably damaging	1.00
R0396:Lrba	UTSW	3	86295179	missense	probably damaging	1.00
R0417:Lrba	UTSW	3	86715654	missense	probably damaging	1.00
R0536:Lrba	UTSW	3	86715532	missense	probably damaging	1.00
R0712:Lrba	UTSW	3	86297990	nonsense	probably null
R0722:Lrba	UTSW	3	86605989	critical splice donor site	probably null
R0828:Lrba	UTSW	3	86608370	splice site	probably null
R0927:Lrba	UTSW	3	86780233	missense	probably damaging	1.00
R1120:Lrba	UTSW	3	86295192	missense	probably damaging	1.00
R1141:Lrba	UTSW	3	86619558	missense	probably damaging	1.00
R1276:Lrba	UTSW	3	86664526	missense	probably damaging	1.00
R1449:Lrba	UTSW	3	86354278	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1474:Lrba	UTSW	3	86780266	splice site	probably benign
R1558:Lrba	UTSW	3	86351315	missense	probably damaging	1.00
R1596:Lrba	UTSW	3	86350304	nonsense	probably null
R1652:Lrba	UTSW	3	86539938	missense	probably damaging	1.00
R1800:Lrba	UTSW	3	86351868	missense	probably benign	0.00
R1819:Lrba	UTSW	3	86542634	missense	possibly damaging	0.80
R1862:Lrba	UTSW	3	86773203	critical splice donor site	probably null
R1917:Lrba	UTSW	3	86664501	missense	probably damaging	1.00
R1965:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1966:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1969:Lrba	UTSW	3	86608389	missense	probably damaging	0.99
R2011:Lrba	UTSW	3	86310017	missense	probably damaging	0.99
R2179:Lrba	UTSW	3	86354281	missense	probably damaging	1.00
R2186:Lrba	UTSW	3	86304336	missense	probably damaging	1.00
R2281:Lrba	UTSW	3	86776103	missense	possibly damaging	0.46
R2359:Lrba	UTSW	3	86348750	missense	probably benign	0.01
R2412:Lrba	UTSW	3	86327700	missense	probably damaging	1.00
R2496:Lrba	UTSW	3	86532087	missense	probably damaging	1.00
R3153:Lrba	UTSW	3	86285219	missense	probably damaging	0.99
R3708:Lrba	UTSW	3	86285024	missense	possibly damaging	0.80
R3746:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3747:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3748:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3749:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3750:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3758:Lrba	UTSW	3	86776049	missense	probably damaging	0.99
R3975:Lrba	UTSW	3	86351255	missense	probably damaging	1.00
R4210:Lrba	UTSW	3	86360126	missense	probably damaging	1.00
R4258:Lrba	UTSW	3	86445349	missense	probably damaging	1.00
R4657:Lrba	UTSW	3	86737164	missense	probably damaging	1.00
R4713:Lrba	UTSW	3	86359868	missense	probably benign	0.13
R4716:Lrba	UTSW	3	86642714	missense	probably damaging	0.99
R4811:Lrba	UTSW	3	86776141	missense	probably damaging	1.00
R4827:Lrba	UTSW	3	86360150	missense	possibly damaging	0.85
R4840:Lrba	UTSW	3	86619509	critical splice acceptor site	probably null
R4920:Lrba	UTSW	3	86664458	nonsense	probably null
R4948:Lrba	UTSW	3	86285028	missense	probably damaging	1.00
R4970:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R4985:Lrba	UTSW	3	86327436	splice site	probably null
R4993:Lrba	UTSW	3	86360037	missense	probably damaging	1.00
R5107:Lrba	UTSW	3	86359779	missense	possibly damaging	0.47
R5112:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R5122:Lrba	UTSW	3	86349154	nonsense	probably null
R5155:Lrba	UTSW	3	86351300	missense	probably benign	0.25
R5194:Lrba	UTSW	3	86328219	missense	probably damaging	1.00
R5280:Lrba	UTSW	3	86325022	missense	possibly damaging	0.94
R5445:Lrba	UTSW	3	86368595	missense	probably benign
R5469:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5513:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5578:Lrba	UTSW	3	86757507	missense	probably benign	0.27
R5740:Lrba	UTSW	3	86328342	missense	probably damaging	1.00
R5868:Lrba	UTSW	3	86319604	missense	probably damaging	1.00
R6104:Lrba	UTSW	3	86353792	missense	probably damaging	1.00
R6166:Lrba	UTSW	3	86354307	critical splice donor site	probably null
R6279:Lrba	UTSW	3	86348864	missense	probably benign	0.26
R6330:Lrba	UTSW	3	86348357	missense	probably benign	0.07
R6367:Lrba	UTSW	3	86368562	missense	probably benign	0.42
R6571:Lrba	UTSW	3	86360060	missense	probably damaging	1.00
R6584:Lrba	UTSW	3	86664576	missense	probably damaging	1.00
R6698:Lrba	UTSW	3	86304425	missense	probably damaging	0.99
R6763:Lrba	UTSW	3	86354263	missense	probably damaging	1.00
R6834:Lrba	UTSW	3	86350286	missense	probably benign	0.00
R6951:Lrba	UTSW	3	86745873	missense	probably benign	0.01
R6969:Lrba	UTSW	3	86619590	missense	probably benign	0.21
R7045:Lrba	UTSW	3	86285091	missense	probably benign	0.03
R7133:Lrba	UTSW	3	86394931	splice site	probably null
R7182:Lrba	UTSW	3	86741458	frame shift	probably null
R7214:Lrba	UTSW	3	86328326	missense	probably damaging	1.00
R7224:Lrba	UTSW	3	86395246	missense	probably damaging	1.00
R7243:Lrba	UTSW	3	86751516	splice site	probably null
R7380:Lrba	UTSW	3	86325074	missense	probably damaging	1.00
R7492:Lrba	UTSW	3	86664528	missense	probably damaging	1.00
R7651:Lrba	UTSW	3	86741466	nonsense	probably null
R7729:Lrba	UTSW	3	86318167	missense	probably damaging	1.00
R7754:Lrba	UTSW	3	86445397	missense	probably damaging	1.00
R7762:Lrba	UTSW	3	86532201	missense	probably damaging	0.99
R7855:Lrba	UTSW	3	86315430	missense	possibly damaging	0.94
R7867:Lrba	UTSW	3	86368589	missense	probably damaging	1.00
R7912:Lrba	UTSW	3	86715565	missense	probably damaging	1.00
R7995:Lrba	UTSW	3	86619551	missense	probably damaging	1.00
R8013:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8014:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8024:Lrba	UTSW	3	86295401	nonsense	probably null
R8027:Lrba	UTSW	3	86417912	missense	probably benign	0.05
R8090:Lrba	UTSW	3	86348489	missense	probably benign
R8111:Lrba	UTSW	3	86327705	missense	probably damaging	1.00
R8118:Lrba	UTSW	3	86354226	missense	probably benign
R8204:Lrba	UTSW	3	86315403	missense	possibly damaging	0.95
R8239:Lrba	UTSW	3	86542575	missense	probably damaging	1.00
R8509:Lrba	UTSW	3	86348176	missense	probably benign	0.04
R8532:Lrba	UTSW	3	86757483	missense	probably damaging	1.00
R8726:Lrba	UTSW	3	86353755	missense	probably benign
R8744:Lrba	UTSW	3	86304333	missense	probably benign	0.08
R8782:Lrba	UTSW	3	86642669	missense	probably benign	0.00
R8784:Lrba	UTSW	3	86375928	missense	probably damaging	1.00
R8922:Lrba	UTSW	3	86356666	missense	probably damaging	1.00
R8964:Lrba	UTSW	3	86351245	missense	probably benign	0.22
R8971:Lrba	UTSW	3	86615081	missense	probably benign	0.00
R9046:Lrba	UTSW	3	86395236	missense	possibly damaging	0.94
R9155:Lrba	UTSW	3	86295201	missense	probably damaging	1.00
R9236:Lrba	UTSW	3	86353759	missense	probably benign	0.05
R9266:Lrba	UTSW	3	86291467	missense	probably benign	0.08
R9297:Lrba	UTSW	3	86373566	missense	probably damaging	1.00
R9404:Lrba	UTSW	3	86297917	missense	probably damaging	0.99
R9617:Lrba	UTSW	3	86359862	missense	probably benign
R9640:Lrba	UTSW	3	86619568	nonsense	probably null
R9779:Lrba	UTSW	3	86325771	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86297899	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86325089	missense	possibly damaging	0.95
Z1176:Lrba	UTSW	3	86715538	missense	probably benign	0.31
Z1176:Lrba	UTSW	3	86751532	missense	possibly damaging	0.85
Z1177:Lrba	UTSW	3	86540049	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTTGTGAAGAATGTGACGG -3'
(R):5'- GGCAACATGATAAGCATATACCTC -3'

Sequencing Primer
(F):5'- TTTCCAATGCTATCCCAAAAGTC -3'
(R):5'- CTTGTACCCAATCGGAGA -3'

Posted On

2019-09-13