Incidental Mutation 'R7350:Spen'
ID570488
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141479385 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 644 (E644K)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect unknown
Transcript: ENSMUST00000078886
AA Change: E621K
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: E621K

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105786
AA Change: E644K
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: E644K

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTATTCGCGAGGCTCATCATAG -3'
(R):5'- GCCAAGTGACTACGTAAGCAC -3'

Sequencing Primer
(F):5'- GTACCGGGAGTCATAATACTCTC -3'
(R):5'- CAGAGCTGCCTGTGTAAGAGAATTTC -3'
Posted On2019-09-13