Mutagenetix > Incidental Mutation

Incidental Mutation 'R7350:Ttc28'

570492

Institutional Source

Beutler Lab

Gene Symbol

Ttc28

Ensembl Gene

ENSMUSG00000033209

Gene Name

tetratricopeptide repeat domain 28

Synonyms

MMRRC Submission

045436-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110879803-111289780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 111226037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1113 (H1113L)

Ref Sequence

ENSEMBL: ENSMUSP00000136116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]

AlphaFold

Q80XJ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000040111
AA Change: H1113L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: H1113L

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	339	372	1.78e-1	SMART
TPR	379	412	2.82e-4	SMART
TPR	419	452	9.98e-5	SMART
TPR	459	492	1.88e0	SMART
TPR	499	532	1.11e1	SMART
TPR	539	572	2.93e-2	SMART
TPR	579	612	1.21e-3	SMART
TPR	619	652	4.91e-4	SMART
TPR	659	692	7.56e-5	SMART
TPR	699	732	8.29e0	SMART
TPR	739	772	1.63e0	SMART
TPR	779	812	1.24e0	SMART
TPR	819	852	7.98e-4	SMART
TPR	859	892	8.74e0	SMART
TPR	902	935	5.43e-6	SMART
TPR	942	975	4.09e-1	SMART
TPR	982	1015	9.98e-5	SMART
TPR	1022	1055	7.12e-1	SMART
TPR	1062	1095	5.69e0	SMART
TPR	1102	1135	3.14e-2	SMART
TPR	1142	1175	2.84e1	SMART
low complexity region	1259	1277	N/A	INTRINSIC
Pfam:CHAT	1415	1738	7.3e-77	PFAM
low complexity region	1972	1990	N/A	INTRINSIC
low complexity region	2014	2031	N/A	INTRINSIC
low complexity region	2033	2045	N/A	INTRINSIC
low complexity region	2155	2171	N/A	INTRINSIC
low complexity region	2283	2293	N/A	INTRINSIC
low complexity region	2327	2352	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156290
AA Change: H1082L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: H1082L

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	308	341	1.78e-1	SMART
TPR	348	381	2.82e-4	SMART
TPR	388	421	9.98e-5	SMART
TPR	428	461	1.88e0	SMART
TPR	468	501	1.11e1	SMART
TPR	508	541	2.93e-2	SMART
TPR	548	581	1.21e-3	SMART
TPR	588	621	4.91e-4	SMART
TPR	628	661	7.56e-5	SMART
TPR	668	701	8.29e0	SMART
TPR	708	741	1.63e0	SMART
TPR	748	781	1.24e0	SMART
TPR	788	821	7.98e-4	SMART
TPR	828	861	8.74e0	SMART
TPR	871	904	5.43e-6	SMART
TPR	911	944	4.09e-1	SMART
TPR	951	984	9.98e-5	SMART
TPR	991	1024	7.12e-1	SMART
TPR	1031	1064	5.69e0	SMART
TPR	1071	1104	3.14e-2	SMART
TPR	1111	1144	2.84e1	SMART
low complexity region	1228	1246	N/A	INTRINSIC
Pfam:CHAT	1384	1707	1.1e-76	PFAM
low complexity region	1941	1959	N/A	INTRINSIC
low complexity region	1983	2000	N/A	INTRINSIC
low complexity region	2002	2014	N/A	INTRINSIC
low complexity region	2124	2140	N/A	INTRINSIC
low complexity region	2252	2262	N/A	INTRINSIC
low complexity region	2296	2321	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	A	T	17: 25,946,711	V534D	probably damaging	Het
Abraxas2	T	C	7: 132,874,849	F106S	probably damaging	Het
Acsf3	A	G	8: 122,785,946	T369A	probably benign	Het
Adgrf5	G	A	17: 43,428,444		probably null	Het
Aff1	T	A	5: 103,847,092	I1052K	probably benign	Het
Akap8	T	C	17: 32,316,575	D155G	possibly damaging	Het
Alg10b	A	T	15: 90,227,450	M166L	probably benign	Het
Allc	T	A	12: 28,563,409	Q178L	possibly damaging	Het
Angptl4	C	A	17: 33,777,110	L297F	probably damaging	Het
Arfgap1	A	G	2: 180,971,076	K8E	possibly damaging	Het
Bckdhb	T	A	9: 84,010,326	V270E	possibly damaging	Het
Cbx3	T	C	6: 51,475,375		probably null	Het
Cd44	G	T	2: 102,834,262	N531K	probably benign	Het
Cdh23	A	T	10: 60,410,910	D916E	probably damaging	Het
Cr2	A	G	1: 195,155,286	V792A	probably benign	Het
Cstf3	T	C	2: 104,608,956	L38P	probably damaging	Het
Cyp2a5	A	G	7: 26,836,783	E151G	probably benign	Het
Dbr1	T	C	9: 99,582,549	F127S		Het
Ddit4	A	T	10: 59,951,495	D6E	probably damaging	Het
Disc1	G	C	8: 125,165,102	R631S	probably damaging	Het
Dnah5	T	A	15: 28,235,819		probably null	Het
Dnah9	T	C	11: 66,080,578	K1595E	probably damaging	Het
Dnmbp	T	C	19: 43,901,505	R608G	probably damaging	Het
Efcab5	G	C	11: 77,137,561	P315A	probably benign	Het
Eif4a2	A	G	16: 23,113,262	Y392C	possibly damaging	Het
F5	G	T	1: 164,192,708	K917N	probably benign	Het
Fig4	T	C	10: 41,251,756	M571V	probably benign	Het
Flot2	T	A	11: 78,057,976	I259N	probably damaging	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gpr152	T	C	19: 4,142,964	V168A	possibly damaging	Het
H1f0	G	A	15: 79,028,903	G61D	probably damaging	Het
Ihh	T	A	1: 74,948,333	K183M	probably damaging	Het
Itga2	A	G	13: 114,837,202	L1116P	probably damaging	Het
Kcnj10	A	G	1: 172,369,260	T114A	possibly damaging	Het
Kcnk3	T	G	5: 30,621,966	L120R	probably damaging	Het
Krt14	C	A	11: 100,205,100	E211*	probably null	Het
Lars2	T	C	9: 123,427,480	L350P	probably damaging	Het
Lrba	T	C	3: 86,351,902	I1408T	probably damaging	Het
Lrrc27	A	G	7: 139,226,106	E229G	probably benign	Het
Lrrc8e	G	T	8: 4,235,626	R617L	probably benign	Het
M1ap	A	G	6: 82,981,949	D187G	probably benign	Het
March1	A	T	8: 66,468,399	K243*	probably null	Het
Med16	C	T	10: 79,903,197	V252M	probably damaging	Het
Micu3	T	C	8: 40,348,958	S189P	probably benign	Het
Mier2	C	A	10: 79,540,298	M264I	unknown	Het
Mindy4	A	T	6: 55,301,025	N618I	probably damaging	Het
Mmrn1	C	T	6: 60,976,336	Q534*	probably null	Het
Mroh9	C	T	1: 163,076,289		probably null	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Mta3	T	A	17: 83,708,441	I24N	probably damaging	Het
Mtmr4	A	T	11: 87,600,650	H147L	probably damaging	Het
Nfam1	T	C	15: 83,010,439	K155R	probably benign	Het
Nlrp6	A	T	7: 140,921,278		probably benign	Het
Olfr1006	A	G	2: 85,674,845	F102S		Het
Olfr1153	T	C	2: 87,896,409		probably benign	Het
Olfr1164	A	T	2: 88,093,198	F246Y	probably benign	Het
Olfr213	A	G	6: 116,540,534	E27G	probably benign	Het
Olfr357	T	A	2: 36,996,861	I17N	possibly damaging	Het
P4ha1	A	G	10: 59,350,418	R240G	probably damaging	Het
Pla2r1	G	T	2: 60,458,379	D636E	probably benign	Het
Polr2a	A	G	11: 69,741,060	L1060P	possibly damaging	Het
Ptgdr2	C	A	19: 10,940,955	Q279K	probably benign	Het
Rab11fip2	T	A	19: 59,937,421	R121S	probably benign	Het
Rasa2	T	C	9: 96,544,355	S813G	probably benign	Het
Rassf5	T	C	1: 131,178,536	K411E	possibly damaging	Het
Reep4	T	C	14: 70,546,547	Y35H	probably damaging	Het
Ror1	A	T	4: 100,425,943	M402L	probably benign	Het
Slc32a1	A	G	2: 158,614,406	E327G	probably damaging	Het
Spen	C	T	4: 141,479,385	E644K	unknown	Het
Tarsl2	C	G	7: 65,658,924	Q281E	probably damaging	Het
Tcl1	A	G	12: 105,218,675	I92T	probably damaging	Het
Tifab	A	G	13: 56,176,307	S108P	probably damaging	Het
Traf1	T	C	2: 34,948,233	N198D	probably benign	Het
Trim35	T	C	14: 66,309,205	Y474H	probably damaging	Het
Trim54	T	A	5: 31,137,161	D344E	probably benign	Het
Vcam1	T	A	3: 116,114,562	D617V	probably damaging	Het
Vmn2r81	A	T	10: 79,268,385	T281S	probably benign	Het
Whrn	C	T	4: 63,431,959	R507K	possibly damaging	Het
Zdhhc14	A	G	17: 5,726,876	S303G	probably benign	Het
Zfp292	A	T	4: 34,806,839	N2073K	probably benign	Het
Zgpat	T	A	2: 181,380,435	V163D		Het

Other mutations in Ttc28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Ttc28	APN	5	111225688	missense	probably damaging	1.00
IGL00963:Ttc28	APN	5	111286389	nonsense	probably null
IGL00969:Ttc28	APN	5	111225740	missense	probably benign	0.00
IGL01366:Ttc28	APN	5	111085171	critical splice donor site	probably null
IGL01528:Ttc28	APN	5	111101960	splice site	probably benign
IGL01558:Ttc28	APN	5	111283962	missense	probably damaging	0.99
IGL01973:Ttc28	APN	5	111224235	missense	possibly damaging	0.88
IGL02040:Ttc28	APN	5	110892936	nonsense	probably null
IGL02432:Ttc28	APN	5	111223235	missense	probably damaging	1.00
IGL02531:Ttc28	APN	5	111225850	missense	probably damaging	1.00
IGL02819:Ttc28	APN	5	111266583	missense	probably benign
IGL02830:Ttc28	APN	5	111286239	missense	probably benign	0.10
IGL02893:Ttc28	APN	5	111285385	missense	possibly damaging	0.87
IGL03387:Ttc28	APN	5	111233342	missense	probably benign	0.07
PIT4131001:Ttc28	UTSW	5	110892853	missense	probably benign	0.00
R0142:Ttc28	UTSW	5	111277457	missense	probably benign	0.40
R0166:Ttc28	UTSW	5	111225634	missense	probably benign	0.01
R0328:Ttc28	UTSW	5	111284067	splice site	probably benign
R0582:Ttc28	UTSW	5	111183296	missense	probably damaging	1.00
R0744:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R0811:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0812:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0828:Ttc28	UTSW	5	111223446	missense	probably damaging	1.00
R0833:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R1013:Ttc28	UTSW	5	111276965	missense	probably benign	0.01
R1168:Ttc28	UTSW	5	111231111	missense	probably damaging	1.00
R1194:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1196:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1205:Ttc28	UTSW	5	111285769	missense	probably benign	0.04
R1386:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1537:Ttc28	UTSW	5	111285318	missense	probably damaging	0.96
R1539:Ttc28	UTSW	5	111100811	missense	possibly damaging	0.77
R1558:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1560:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1561:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1566:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1768:Ttc28	UTSW	5	111277168	missense	possibly damaging	0.77
R1775:Ttc28	UTSW	5	111276811	missense	probably benign	0.00
R1909:Ttc28	UTSW	5	111284054	critical splice donor site	probably null
R1911:Ttc28	UTSW	5	111280750	missense	possibly damaging	0.93
R1970:Ttc28	UTSW	5	111235635	missense	probably benign	0.00
R1990:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R1992:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R2066:Ttc28	UTSW	5	111225933	missense	probably benign	0.01
R2112:Ttc28	UTSW	5	111276273	missense	probably damaging	0.99
R2158:Ttc28	UTSW	5	111177617	intron	probably benign
R2192:Ttc28	UTSW	5	111223496	missense	probably damaging	0.99
R2267:Ttc28	UTSW	5	111226003	missense	possibly damaging	0.75
R2384:Ttc28	UTSW	5	111276208	missense	possibly damaging	0.95
R2989:Ttc28	UTSW	5	111224015	missense	probably benign	0.29
R3881:Ttc28	UTSW	5	111183240	missense	probably damaging	1.00
R3919:Ttc28	UTSW	5	111285379	missense	possibly damaging	0.80
R4455:Ttc28	UTSW	5	111224058	frame shift	probably null
R4456:Ttc28	UTSW	5	111224058	frame shift	probably null
R4522:Ttc28	UTSW	5	111280172	missense	probably benign	0.01
R4548:Ttc28	UTSW	5	111271224	missense	possibly damaging	0.86
R4591:Ttc28	UTSW	5	111223281	missense	probably damaging	1.00
R4633:Ttc28	UTSW	5	111224001	missense	probably damaging	1.00
R4700:Ttc28	UTSW	5	111277043	missense	probably damaging	1.00
R4714:Ttc28	UTSW	5	111285229	missense	possibly damaging	0.65
R4790:Ttc28	UTSW	5	111224217	missense	possibly damaging	0.94
R4803:Ttc28	UTSW	5	111277463	missense	possibly damaging	0.90
R4840:Ttc28	UTSW	5	111286081	missense	probably damaging	1.00
R4969:Ttc28	UTSW	5	111276255	missense	probably damaging	0.96
R5019:Ttc28	UTSW	5	111102064	missense	possibly damaging	0.47
R5130:Ttc28	UTSW	5	110892856	missense	probably benign
R5150:Ttc28	UTSW	5	111225689	missense	probably damaging	1.00
R5214:Ttc28	UTSW	5	111177623	intron	probably benign
R5254:Ttc28	UTSW	5	111271238	missense	probably benign	0.01
R5518:Ttc28	UTSW	5	111225928	missense	probably benign	0.17
R5851:Ttc28	UTSW	5	111235469	splice site	probably benign
R5931:Ttc28	UTSW	5	111085109	missense	possibly damaging	0.81
R6011:Ttc28	UTSW	5	111286443	missense	probably benign
R6176:Ttc28	UTSW	5	111223985	missense	probably damaging	1.00
R6221:Ttc28	UTSW	5	111271248	missense	probably benign	0.00
R6398:Ttc28	UTSW	5	111276276	missense	probably damaging	1.00
R6717:Ttc28	UTSW	5	111285436	missense	probably benign
R6770:Ttc28	UTSW	5	111286140	missense	probably damaging	1.00
R6901:Ttc28	UTSW	5	111277025	missense	possibly damaging	0.88
R7038:Ttc28	UTSW	5	111266579	missense	probably benign	0.09
R7073:Ttc28	UTSW	5	111223416	missense	possibly damaging	0.96
R7101:Ttc28	UTSW	5	111085092	missense	probably damaging	1.00
R7135:Ttc28	UTSW	5	111280007	missense	probably damaging	1.00
R7454:Ttc28	UTSW	5	111285484	missense	probably benign	0.19
R7461:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7596:Ttc28	UTSW	5	111280124	missense	probably damaging	1.00
R7613:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7625:Ttc28	UTSW	5	111285219	missense	possibly damaging	0.65
R7648:Ttc28	UTSW	5	111183392	missense	possibly damaging	0.52
R7735:Ttc28	UTSW	5	111266678	splice site	probably null
R8030:Ttc28	UTSW	5	111286056	missense	possibly damaging	0.81
R8205:Ttc28	UTSW	5	111225730	missense	possibly damaging	0.95
R8246:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8247:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8269:Ttc28	UTSW	5	111277459	missense	probably benign	0.09
R8292:Ttc28	UTSW	5	111223257	missense	probably damaging	1.00
R8346:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8356:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8423:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8424:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8426:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8441:Ttc28	UTSW	5	111177641	nonsense	probably null
R8494:Ttc28	UTSW	5	111235640	missense	probably damaging	0.96
R8508:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8510:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8729:Ttc28	UTSW	5	111235643	critical splice donor site	probably null
R8845:Ttc28	UTSW	5	111224175	missense	probably benign	0.11
R9003:Ttc28	UTSW	5	111277030	missense	probably benign	0.00
R9185:Ttc28	UTSW	5	111223476	missense	probably benign	0.03
R9187:Ttc28	UTSW	5	111102036	missense	probably damaging	1.00
R9245:Ttc28	UTSW	5	111177659	missense	unknown
R9251:Ttc28	UTSW	5	110892832	missense	possibly damaging	0.47
R9372:Ttc28	UTSW	5	111183207	missense	probably benign	0.25
R9466:Ttc28	UTSW	5	111183029	missense	probably damaging	0.99
R9563:Ttc28	UTSW	5	111223226	missense	probably benign	0.22
R9606:Ttc28	UTSW	5	111285274	missense	probably benign	0.00
R9691:Ttc28	UTSW	5	111284013	missense	probably benign	0.01
R9709:Ttc28	UTSW	5	111285771	missense	probably damaging	0.97
V8831:Ttc28	UTSW	5	111100712	missense	probably benign	0.11
Z1088:Ttc28	UTSW	5	111286315	missense	probably benign	0.00
Z1176:Ttc28	UTSW	5	111266566	missense	possibly damaging	0.59
Z1177:Ttc28	UTSW	5	111278586	missense	probably damaging	1.00
Z1177:Ttc28	UTSW	5	111285739	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TTGCCAGGGACATGAAGGAC -3'
(R):5'- TATTTGGGCAGCAGGTCAGG -3'

Sequencing Primer
(F):5'- AGCTCGACCTGCAGATTG -3'
(R):5'- CTTCTACAGCACTGGCT -3'

Posted On

2019-09-13