Incidental Mutation 'R7350:Cbx3'
ID 570493
Institutional Source Beutler Lab
Gene Symbol Cbx3
Ensembl Gene ENSMUSG00000029836
Gene Name chromobox 3
Synonyms M32, heterochromatin protein 1 gamma, HP1g
MMRRC Submission 045436-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.581) question?
Stock # R7350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 51447596-51460684 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 51452355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031862] [ENSMUST00000094623] [ENSMUST00000114445] [ENSMUST00000114446] [ENSMUST00000141711]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000031862
SMART Domains Protein: ENSMUSP00000031862
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000094623
SMART Domains Protein: ENSMUSP00000110091
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114445
SMART Domains Protein: ENSMUSP00000110088
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
Pfam:Chromo 30 60 1.4e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114446
SMART Domains Protein: ENSMUSP00000110089
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141711
SMART Domains Protein: ENSMUSP00000121370
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 109 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] At the nuclear envelope, the nuclear lamina and heterochromatin are adjacent to the inner nuclear membrane. The protein encoded by this gene binds DNA and is a component of heterochromatin. This protein also can bind lamin B receptor, an integral membrane protein found in the inner nuclear membrane. The dual binding functions of the encoded protein may explain the association of heterochromatin with the inner nuclear membrane. This protein binds histone H3 tails methylated at Lys-9 sites. This protein is also recruited to sites of ultraviolet-induced DNA damage and double-strand breaks. Two transcript variants encoding the same protein but differing in the 5' UTR, have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trap allele are infertile. Mice homozygous for a hypomorphic targeted allele exhibit partial postnatal lethality and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 T C 7: 132,476,578 (GRCm39) F106S probably damaging Het
Acsf3 A G 8: 123,512,685 (GRCm39) T369A probably benign Het
Adgrf5 G A 17: 43,739,335 (GRCm39) probably null Het
Aff1 T A 5: 103,994,958 (GRCm39) I1052K probably benign Het
Akap8 T C 17: 32,535,549 (GRCm39) D155G possibly damaging Het
Alg10b A T 15: 90,111,653 (GRCm39) M166L probably benign Het
Allc T A 12: 28,613,408 (GRCm39) Q178L possibly damaging Het
Angptl4 C A 17: 33,996,084 (GRCm39) L297F probably damaging Het
Arfgap1 A G 2: 180,612,869 (GRCm39) K8E possibly damaging Het
Bckdhb T A 9: 83,892,379 (GRCm39) V270E possibly damaging Het
Cd44 G T 2: 102,664,607 (GRCm39) N531K probably benign Het
Cdh23 A T 10: 60,246,689 (GRCm39) D916E probably damaging Het
Cr2 A G 1: 194,837,594 (GRCm39) V792A probably benign Het
Cstf3 T C 2: 104,439,301 (GRCm39) L38P probably damaging Het
Cyp2a5 A G 7: 26,536,208 (GRCm39) E151G probably benign Het
Dbr1 T C 9: 99,464,602 (GRCm39) F127S Het
Ddit4 A T 10: 59,787,317 (GRCm39) D6E probably damaging Het
Disc1 G C 8: 125,891,841 (GRCm39) R631S probably damaging Het
Dnah5 T A 15: 28,235,965 (GRCm39) probably null Het
Dnah9 T C 11: 65,971,404 (GRCm39) K1595E probably damaging Het
Dnmbp T C 19: 43,889,944 (GRCm39) R608G probably damaging Het
Efcab5 G C 11: 77,028,387 (GRCm39) P315A probably benign Het
Eif4a2 A G 16: 22,932,012 (GRCm39) Y392C possibly damaging Het
F5 G T 1: 164,020,277 (GRCm39) K917N probably benign Het
Fig4 T C 10: 41,127,752 (GRCm39) M571V probably benign Het
Flot2 T A 11: 77,948,802 (GRCm39) I259N probably damaging Het
Gm8122 C A 14: 43,088,058 (GRCm39) probably null Het
Gpr152 T C 19: 4,192,963 (GRCm39) V168A possibly damaging Het
H1f0 G A 15: 78,913,103 (GRCm39) G61D probably damaging Het
Ihh T A 1: 74,987,492 (GRCm39) K183M probably damaging Het
Itga2 A G 13: 114,973,738 (GRCm39) L1116P probably damaging Het
Kcnj10 A G 1: 172,196,827 (GRCm39) T114A possibly damaging Het
Kcnk3 T G 5: 30,779,310 (GRCm39) L120R probably damaging Het
Krt14 C A 11: 100,095,926 (GRCm39) E211* probably null Het
Lars2 T C 9: 123,256,545 (GRCm39) L350P probably damaging Het
Lrba T C 3: 86,259,209 (GRCm39) I1408T probably damaging Het
Lrrc27 A G 7: 138,806,022 (GRCm39) E229G probably benign Het
Lrrc8e G T 8: 4,285,626 (GRCm39) R617L probably benign Het
M1ap A G 6: 82,958,930 (GRCm39) D187G probably benign Het
Marchf1 A T 8: 66,921,051 (GRCm39) K243* probably null Het
Med16 C T 10: 79,739,031 (GRCm39) V252M probably damaging Het
Micu3 T C 8: 40,801,999 (GRCm39) S189P probably benign Het
Mier2 C A 10: 79,376,132 (GRCm39) M264I unknown Het
Mindy4 A T 6: 55,278,010 (GRCm39) N618I probably damaging Het
Mmrn1 C T 6: 60,953,320 (GRCm39) Q534* probably null Het
Mroh9 C T 1: 162,903,858 (GRCm39) probably null Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Mta3 T A 17: 84,015,870 (GRCm39) I24N probably damaging Het
Mtmr4 A T 11: 87,491,476 (GRCm39) H147L probably damaging Het
Nfam1 T C 15: 82,894,640 (GRCm39) K155R probably benign Het
Nlrp6 A T 7: 140,501,191 (GRCm39) probably benign Het
Or1q1 T A 2: 36,886,873 (GRCm39) I17N possibly damaging Het
Or5d37 A T 2: 87,923,542 (GRCm39) F246Y probably benign Het
Or5w20 T C 2: 87,726,753 (GRCm39) probably benign Het
Or6d13 A G 6: 116,517,495 (GRCm39) E27G probably benign Het
Or9g4 A G 2: 85,505,189 (GRCm39) F102S Het
P4ha1 A G 10: 59,186,240 (GRCm39) R240G probably damaging Het
Pla2r1 G T 2: 60,288,723 (GRCm39) D636E probably benign Het
Polr2a A G 11: 69,631,886 (GRCm39) L1060P possibly damaging Het
Prr35 A T 17: 26,165,685 (GRCm39) V534D probably damaging Het
Ptgdr2 C A 19: 10,918,319 (GRCm39) Q279K probably benign Het
Rab11fip2 T A 19: 59,925,853 (GRCm39) R121S probably benign Het
Rasa2 T C 9: 96,426,408 (GRCm39) S813G probably benign Het
Rassf5 T C 1: 131,106,273 (GRCm39) K411E possibly damaging Het
Reep4 T C 14: 70,783,987 (GRCm39) Y35H probably damaging Het
Ror1 A T 4: 100,283,140 (GRCm39) M402L probably benign Het
Slc32a1 A G 2: 158,456,326 (GRCm39) E327G probably damaging Het
Spen C T 4: 141,206,696 (GRCm39) E644K unknown Het
Tars3 C G 7: 65,308,672 (GRCm39) Q281E probably damaging Het
Tcl1 A G 12: 105,184,934 (GRCm39) I92T probably damaging Het
Tifab A G 13: 56,324,120 (GRCm39) S108P probably damaging Het
Traf1 T C 2: 34,838,245 (GRCm39) N198D probably benign Het
Trim35 T C 14: 66,546,654 (GRCm39) Y474H probably damaging Het
Trim54 T A 5: 31,294,505 (GRCm39) D344E probably benign Het
Ttc28 A T 5: 111,373,903 (GRCm39) H1113L probably damaging Het
Vcam1 T A 3: 115,908,211 (GRCm39) D617V probably damaging Het
Vmn2r81 A T 10: 79,104,219 (GRCm39) T281S probably benign Het
Whrn C T 4: 63,350,196 (GRCm39) R507K possibly damaging Het
Zdhhc14 A G 17: 5,777,151 (GRCm39) S303G probably benign Het
Zfp292 A T 4: 34,806,839 (GRCm39) N2073K probably benign Het
Zgpat T A 2: 181,022,228 (GRCm39) V163D Het
Other mutations in Cbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Cbx3 APN 6 51,452,281 (GRCm39) missense probably damaging 0.97
R2037:Cbx3 UTSW 6 51,448,793 (GRCm39) splice site probably null
R4877:Cbx3 UTSW 6 51,459,540 (GRCm39) missense possibly damaging 0.59
R5138:Cbx3 UTSW 6 51,452,269 (GRCm39) missense probably damaging 1.00
R5518:Cbx3 UTSW 6 51,458,726 (GRCm39) missense probably benign 0.12
R7465:Cbx3 UTSW 6 51,455,510 (GRCm39) missense probably benign 0.00
R8093:Cbx3 UTSW 6 51,458,748 (GRCm39) missense possibly damaging 0.72
R8230:Cbx3 UTSW 6 51,452,281 (GRCm39) missense probably damaging 0.97
R8244:Cbx3 UTSW 6 51,452,350 (GRCm39) missense probably benign 0.00
R9151:Cbx3 UTSW 6 51,455,533 (GRCm39) missense probably benign 0.00
X0020:Cbx3 UTSW 6 51,458,732 (GRCm39) missense probably benign 0.20
X0025:Cbx3 UTSW 6 51,459,495 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTCAGATGAATGAACAATTTGGCC -3'
(R):5'- CTTCTAAAGCACCGTTAAAGGTAC -3'

Sequencing Primer
(F):5'- TGAACAATTTGGCCTTAAAAATGTAC -3'
(R):5'- ACTCACTTTAGTAGACCAGGCTGG -3'
Posted On 2019-09-13