Incidental Mutation 'R7350:Olfr213'
ID570497
Institutional Source Beutler Lab
Gene Symbol Olfr213
Ensembl Gene ENSMUSG00000081649
Gene Nameolfactory receptor 213
SynonymsGA_x54KRFPKN04-58174409-58175392, MOR119-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116538456-116544292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116540534 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 27 (E27G)
Ref Sequence ENSEMBL: ENSMUSP00000151916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121958] [ENSMUST00000220008]
Predicted Effect probably benign
Transcript: ENSMUST00000121958
AA Change: E27G

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112931
Gene: ENSMUSG00000081649
AA Change: E27G

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4e-45 PFAM
Pfam:7tm_1 47 296 5.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220008
AA Change: E27G

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Olfr213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr213 APN 6 116541007 missense probably damaging 1.00
IGL02671:Olfr213 APN 6 116541143 missense possibly damaging 0.50
IGL03107:Olfr213 APN 6 116540939 missense possibly damaging 0.82
R0041:Olfr213 UTSW 6 116541334 missense possibly damaging 0.55
R0426:Olfr213 UTSW 6 116540485 missense probably damaging 1.00
R0627:Olfr213 UTSW 6 116540988 missense possibly damaging 0.56
R0829:Olfr213 UTSW 6 116541265 missense probably benign 0.01
R2111:Olfr213 UTSW 6 116540650 missense possibly damaging 0.95
R2112:Olfr213 UTSW 6 116540650 missense possibly damaging 0.95
R2120:Olfr213 UTSW 6 116540455 start codon destroyed probably null 0.04
R3161:Olfr213 UTSW 6 116540846 missense probably damaging 1.00
R3700:Olfr213 UTSW 6 116540528 missense probably benign 0.10
R4710:Olfr213 UTSW 6 116540650 missense possibly damaging 0.95
R5244:Olfr213 UTSW 6 116541226 missense probably damaging 1.00
R5859:Olfr213 UTSW 6 116540900 missense probably damaging 1.00
R6273:Olfr213 UTSW 6 116541316 missense possibly damaging 0.74
R6505:Olfr213 UTSW 6 116540600 missense probably benign 0.01
R7380:Olfr213 UTSW 6 116540933 missense probably benign 0.03
R7474:Olfr213 UTSW 6 116541038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGAATGTCTTCCCATGTC -3'
(R):5'- AAGGAGATGGTTTGCCTCCC -3'

Sequencing Primer
(F):5'- GAATGTCTTCCCATGTCATTTACAGG -3'
(R):5'- GTTTGCCTCCCTGACAGAAAGATG -3'
Posted On2019-09-13