Incidental Mutation 'R7350:Marchf1'
ID 570505
Institutional Source Beutler Lab
Gene Symbol Marchf1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane associated ring-CH-type finger 1
Synonyms March1, 2900024D24Rik
MMRRC Submission 045436-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R7350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 66070552-66924289 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 66921051 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 243 (K243*)
Ref Sequence ENSEMBL: ENSMUSP00000105884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026681] [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
AlphaFold Q6NZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000026681
SMART Domains Protein: ENSMUSP00000026681
Gene: ENSMUSG00000025591

DomainStartEndE-ValueType
Pfam:DUF2962 10 162 1.6e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039540
AA Change: K233*
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469
AA Change: K233*

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072482
AA Change: K243*
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469
AA Change: K243*

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098708
AA Change: K243*
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469
AA Change: K243*

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110253
AA Change: K237*
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469
AA Change: K237*

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110255
AA Change: K243*
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469
AA Change: K243*

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110256
AA Change: K498*
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: K498*

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110258
AA Change: K247*
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469
AA Change: K247*

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110259
AA Change: K243*
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469
AA Change: K243*

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178982
AA Change: K247*
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469
AA Change: K247*

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 T C 7: 132,476,578 (GRCm39) F106S probably damaging Het
Acsf3 A G 8: 123,512,685 (GRCm39) T369A probably benign Het
Adgrf5 G A 17: 43,739,335 (GRCm39) probably null Het
Aff1 T A 5: 103,994,958 (GRCm39) I1052K probably benign Het
Akap8 T C 17: 32,535,549 (GRCm39) D155G possibly damaging Het
Alg10b A T 15: 90,111,653 (GRCm39) M166L probably benign Het
Allc T A 12: 28,613,408 (GRCm39) Q178L possibly damaging Het
Angptl4 C A 17: 33,996,084 (GRCm39) L297F probably damaging Het
Arfgap1 A G 2: 180,612,869 (GRCm39) K8E possibly damaging Het
Bckdhb T A 9: 83,892,379 (GRCm39) V270E possibly damaging Het
Cbx3 T C 6: 51,452,355 (GRCm39) probably null Het
Cd44 G T 2: 102,664,607 (GRCm39) N531K probably benign Het
Cdh23 A T 10: 60,246,689 (GRCm39) D916E probably damaging Het
Cr2 A G 1: 194,837,594 (GRCm39) V792A probably benign Het
Cstf3 T C 2: 104,439,301 (GRCm39) L38P probably damaging Het
Cyp2a5 A G 7: 26,536,208 (GRCm39) E151G probably benign Het
Dbr1 T C 9: 99,464,602 (GRCm39) F127S Het
Ddit4 A T 10: 59,787,317 (GRCm39) D6E probably damaging Het
Disc1 G C 8: 125,891,841 (GRCm39) R631S probably damaging Het
Dnah5 T A 15: 28,235,965 (GRCm39) probably null Het
Dnah9 T C 11: 65,971,404 (GRCm39) K1595E probably damaging Het
Dnmbp T C 19: 43,889,944 (GRCm39) R608G probably damaging Het
Efcab5 G C 11: 77,028,387 (GRCm39) P315A probably benign Het
Eif4a2 A G 16: 22,932,012 (GRCm39) Y392C possibly damaging Het
F5 G T 1: 164,020,277 (GRCm39) K917N probably benign Het
Fig4 T C 10: 41,127,752 (GRCm39) M571V probably benign Het
Flot2 T A 11: 77,948,802 (GRCm39) I259N probably damaging Het
Gm8122 C A 14: 43,088,058 (GRCm39) probably null Het
Gpr152 T C 19: 4,192,963 (GRCm39) V168A possibly damaging Het
H1f0 G A 15: 78,913,103 (GRCm39) G61D probably damaging Het
Ihh T A 1: 74,987,492 (GRCm39) K183M probably damaging Het
Itga2 A G 13: 114,973,738 (GRCm39) L1116P probably damaging Het
Kcnj10 A G 1: 172,196,827 (GRCm39) T114A possibly damaging Het
Kcnk3 T G 5: 30,779,310 (GRCm39) L120R probably damaging Het
Krt14 C A 11: 100,095,926 (GRCm39) E211* probably null Het
Lars2 T C 9: 123,256,545 (GRCm39) L350P probably damaging Het
Lrba T C 3: 86,259,209 (GRCm39) I1408T probably damaging Het
Lrrc27 A G 7: 138,806,022 (GRCm39) E229G probably benign Het
Lrrc8e G T 8: 4,285,626 (GRCm39) R617L probably benign Het
M1ap A G 6: 82,958,930 (GRCm39) D187G probably benign Het
Med16 C T 10: 79,739,031 (GRCm39) V252M probably damaging Het
Micu3 T C 8: 40,801,999 (GRCm39) S189P probably benign Het
Mier2 C A 10: 79,376,132 (GRCm39) M264I unknown Het
Mindy4 A T 6: 55,278,010 (GRCm39) N618I probably damaging Het
Mmrn1 C T 6: 60,953,320 (GRCm39) Q534* probably null Het
Mroh9 C T 1: 162,903,858 (GRCm39) probably null Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Mta3 T A 17: 84,015,870 (GRCm39) I24N probably damaging Het
Mtmr4 A T 11: 87,491,476 (GRCm39) H147L probably damaging Het
Nfam1 T C 15: 82,894,640 (GRCm39) K155R probably benign Het
Nlrp6 A T 7: 140,501,191 (GRCm39) probably benign Het
Or1q1 T A 2: 36,886,873 (GRCm39) I17N possibly damaging Het
Or5d37 A T 2: 87,923,542 (GRCm39) F246Y probably benign Het
Or5w20 T C 2: 87,726,753 (GRCm39) probably benign Het
Or6d13 A G 6: 116,517,495 (GRCm39) E27G probably benign Het
Or9g4 A G 2: 85,505,189 (GRCm39) F102S Het
P4ha1 A G 10: 59,186,240 (GRCm39) R240G probably damaging Het
Pla2r1 G T 2: 60,288,723 (GRCm39) D636E probably benign Het
Polr2a A G 11: 69,631,886 (GRCm39) L1060P possibly damaging Het
Prr35 A T 17: 26,165,685 (GRCm39) V534D probably damaging Het
Ptgdr2 C A 19: 10,918,319 (GRCm39) Q279K probably benign Het
Rab11fip2 T A 19: 59,925,853 (GRCm39) R121S probably benign Het
Rasa2 T C 9: 96,426,408 (GRCm39) S813G probably benign Het
Rassf5 T C 1: 131,106,273 (GRCm39) K411E possibly damaging Het
Reep4 T C 14: 70,783,987 (GRCm39) Y35H probably damaging Het
Ror1 A T 4: 100,283,140 (GRCm39) M402L probably benign Het
Slc32a1 A G 2: 158,456,326 (GRCm39) E327G probably damaging Het
Spen C T 4: 141,206,696 (GRCm39) E644K unknown Het
Tars3 C G 7: 65,308,672 (GRCm39) Q281E probably damaging Het
Tcl1 A G 12: 105,184,934 (GRCm39) I92T probably damaging Het
Tifab A G 13: 56,324,120 (GRCm39) S108P probably damaging Het
Traf1 T C 2: 34,838,245 (GRCm39) N198D probably benign Het
Trim35 T C 14: 66,546,654 (GRCm39) Y474H probably damaging Het
Trim54 T A 5: 31,294,505 (GRCm39) D344E probably benign Het
Ttc28 A T 5: 111,373,903 (GRCm39) H1113L probably damaging Het
Vcam1 T A 3: 115,908,211 (GRCm39) D617V probably damaging Het
Vmn2r81 A T 10: 79,104,219 (GRCm39) T281S probably benign Het
Whrn C T 4: 63,350,196 (GRCm39) R507K possibly damaging Het
Zdhhc14 A G 17: 5,777,151 (GRCm39) S303G probably benign Het
Zfp292 A T 4: 34,806,839 (GRCm39) N2073K probably benign Het
Zgpat T A 2: 181,022,228 (GRCm39) V163D Het
Other mutations in Marchf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Marchf1 APN 8 66,871,529 (GRCm39) missense possibly damaging 0.88
IGL02468:Marchf1 APN 8 66,871,563 (GRCm39) missense probably damaging 1.00
R0391:Marchf1 UTSW 8 66,871,625 (GRCm39) missense probably damaging 1.00
R1500:Marchf1 UTSW 8 66,921,042 (GRCm39) missense probably damaging 1.00
R1794:Marchf1 UTSW 8 66,839,594 (GRCm39) missense possibly damaging 0.63
R2015:Marchf1 UTSW 8 66,574,473 (GRCm39) missense probably damaging 0.99
R2184:Marchf1 UTSW 8 66,840,075 (GRCm39) missense probably benign 0.07
R2273:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2274:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2275:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2314:Marchf1 UTSW 8 66,574,442 (GRCm39) start codon destroyed probably null 0.77
R3114:Marchf1 UTSW 8 66,840,033 (GRCm39) missense probably benign
R4458:Marchf1 UTSW 8 66,908,823 (GRCm39) missense probably damaging 1.00
R4656:Marchf1 UTSW 8 66,839,071 (GRCm39) missense probably benign 0.05
R4773:Marchf1 UTSW 8 66,839,876 (GRCm39) missense probably benign 0.03
R4838:Marchf1 UTSW 8 66,921,015 (GRCm39) missense probably damaging 1.00
R5073:Marchf1 UTSW 8 66,839,020 (GRCm39) missense probably benign 0.03
R5507:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R5575:Marchf1 UTSW 8 66,920,962 (GRCm39) missense probably damaging 1.00
R5916:Marchf1 UTSW 8 66,839,763 (GRCm39) missense possibly damaging 0.89
R6931:Marchf1 UTSW 8 66,921,144 (GRCm39) missense probably benign 0.03
R7487:Marchf1 UTSW 8 66,908,726 (GRCm39) missense probably benign 0.14
R7531:Marchf1 UTSW 8 66,838,989 (GRCm39) missense probably benign
R7563:Marchf1 UTSW 8 66,920,965 (GRCm39) missense probably damaging 1.00
R7705:Marchf1 UTSW 8 66,921,169 (GRCm39) missense probably benign 0.00
R8142:Marchf1 UTSW 8 66,908,778 (GRCm39) missense probably benign 0.07
R8337:Marchf1 UTSW 8 66,871,641 (GRCm39) missense probably damaging 1.00
R8712:Marchf1 UTSW 8 66,921,000 (GRCm39) missense probably damaging 1.00
R9188:Marchf1 UTSW 8 66,908,803 (GRCm39) nonsense probably null
R9372:Marchf1 UTSW 8 66,921,145 (GRCm39) missense probably benign 0.01
R9477:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R9790:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
R9791:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTCTTTCTCAAAGGTGTGCTGG -3'
(R):5'- TTAAGAAGCCACCAGAGCAG -3'

Sequencing Primer
(F):5'- CTCAAAGGTGTGCTGGAATGGC -3'
(R):5'- AAGCACTTCTGTTGGTAGTGGC -3'
Posted On 2019-09-13