Incidental Mutation 'R7350:Disc1'
ID570507
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Namedisrupted in schizophrenia 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125054195-125261858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 125165102 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 631 (R631S)
Ref Sequence ENSEMBL: ENSMUSP00000095914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953]
Predicted Effect probably damaging
Transcript: ENSMUST00000074562
AA Change: R631S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: R631S

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075730
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098311
AA Change: R631S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: R631S

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115885
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117658
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118942
AA Change: R631S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: R631S

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121953
AA Change: R629S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: R629S

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125088275 missense probably benign 0.27
IGL01319:Disc1 APN 8 125087891 missense probably damaging 0.99
IGL02001:Disc1 APN 8 125251042 missense probably damaging 0.97
IGL02403:Disc1 APN 8 125135519 splice site probably benign
IGL02445:Disc1 APN 8 125148403 splice site probably benign
R0334:Disc1 UTSW 8 125261097 synonymous probably null
R0992:Disc1 UTSW 8 125088042 missense probably damaging 1.00
R1654:Disc1 UTSW 8 125148465 missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125124610 missense probably benign 0.05
R3154:Disc1 UTSW 8 125135304 missense probably damaging 1.00
R3947:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3948:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3949:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R4051:Disc1 UTSW 8 125148425 missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125148459 missense probably damaging 1.00
R4691:Disc1 UTSW 8 125148447 missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125124538 missense probably damaging 1.00
R4825:Disc1 UTSW 8 125135302 missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125124550 nonsense probably null
R5087:Disc1 UTSW 8 125132160 missense probably benign
R5383:Disc1 UTSW 8 125135457 missense probably damaging 1.00
R5827:Disc1 UTSW 8 125135365 missense probably damaging 1.00
R5828:Disc1 UTSW 8 125251024 missense probably damaging 0.99
R6431:Disc1 UTSW 8 125135389 missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125218105 missense probably benign 0.00
R6794:Disc1 UTSW 8 125087775 missense probably benign 0.37
R7058:Disc1 UTSW 8 125250985 missense probably damaging 1.00
R7365:Disc1 UTSW 8 125155041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGTATTATTCTCAGAGGCATC -3'
(R):5'- TCTGCCACTGTCACAGCAAG -3'

Sequencing Primer
(F):5'- AGAGTCATTCTCCTCTGGGGAC -3'
(R):5'- AGGTGATCTAGCCACAGGATCC -3'
Posted On2019-09-13