Incidental Mutation 'R7350:Dbr1'
ID570510
Institutional Source Beutler Lab
Gene Symbol Dbr1
Ensembl Gene ENSMUSG00000032469
Gene Namedebranching RNA lariats 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location99575799-99584501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99582549 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 127 (F127S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066650] [ENSMUST00000139796] [ENSMUST00000148987]
Predicted Effect probably benign
Transcript: ENSMUST00000066650
SMART Domains Protein: ENSMUSP00000070991
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 1 230 1.8e-11 PFAM
DBR1 235 380 8.27e-85 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114670
Gene: ENSMUSG00000032469
AA Change: F127S

DomainStartEndE-ValueType
DBR1 20 128 4.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138002
SMART Domains Protein: ENSMUSP00000119924
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 2 144 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139796
SMART Domains Protein: ENSMUSP00000115203
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:DBR1 52 82 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148987
SMART Domains Protein: ENSMUSP00000115074
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 162 231 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156035
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA lariat debranching enzyme that hydrolyzes 2'-5' prime branched phosphodiester bonds. The encoded protein specifically targets the bonds at the branch point of excised lariat intron RNA, converting them to linear molecules that are then degraded. This protein may also be involved in retroviral replication. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit impaired class switch recombination in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Dbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Dbr1 APN 9 99575978 missense probably damaging 1.00
IGL01952:Dbr1 APN 9 99582412 missense possibly damaging 0.64
IGL01995:Dbr1 APN 9 99583899 missense probably benign 0.00
FR4340:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4342:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583674 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4548:Dbr1 UTSW 9 99583673 nonsense probably null
FR4589:Dbr1 UTSW 9 99583677 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583683 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583699 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583689 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583692 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583702 unclassified probably benign
PIT4131001:Dbr1 UTSW 9 99584019 unclassified probably null
R0100:Dbr1 UTSW 9 99583669 missense probably benign 0.01
R1240:Dbr1 UTSW 9 99584020 missense probably benign 0.44
R1502:Dbr1 UTSW 9 99582387 missense probably damaging 1.00
R2265:Dbr1 UTSW 9 99579410 missense probably damaging 1.00
R2279:Dbr1 UTSW 9 99580147 missense probably benign 0.06
R5202:Dbr1 UTSW 9 99583891 missense probably benign 0.00
R7012:Dbr1 UTSW 9 99583321 nonsense probably null
R7025:Dbr1 UTSW 9 99575983 missense probably damaging 1.00
R7037:Dbr1 UTSW 9 99576568 splice site probably null
R7192:Dbr1 UTSW 9 99576702 critical splice donor site probably null
R7396:Dbr1 UTSW 9 99583390 missense probably damaging 1.00
R7601:Dbr1 UTSW 9 99582602 nonsense probably null
R7659:Dbr1 UTSW 9 99576610 missense probably damaging 1.00
RF028:Dbr1 UTSW 9 99583697 nonsense probably null
RF033:Dbr1 UTSW 9 99583697 nonsense probably null
RF038:Dbr1 UTSW 9 99583697 unclassified probably benign
RF040:Dbr1 UTSW 9 99583697 nonsense probably null
RF043:Dbr1 UTSW 9 99583697 unclassified probably benign
RF045:Dbr1 UTSW 9 99583671 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTCCTGAGTACTTAGAGTATGAC -3'
(R):5'- AGTACAAAGTTGGGGTCTCATGG -3'

Sequencing Primer
(F):5'- AGAGTATGACGTTGAATGGCTTAC -3'
(R):5'- ATGGCCAGTCAGTGCCAGAAC -3'
Posted On2019-09-13