Incidental Mutation 'R7350:Lars2'
ID570511
Institutional Source Beutler Lab
Gene Symbol Lars2
Ensembl Gene ENSMUSG00000035202
Gene Nameleucyl-tRNA synthetase, mitochondrial
SynonymsKiaa0028
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location123366927-123462666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123427480 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 350 (L350P)
Ref Sequence ENSEMBL: ENSMUSP00000036710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]
Predicted Effect probably damaging
Transcript: ENSMUST00000038863
AA Change: L350P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: L350P

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 57 223 7.6e-24 PFAM
Pfam:tRNA-synt_1g 83 239 9.3e-20 PFAM
Pfam:tRNA-synt_1_2 269 430 1.1e-8 PFAM
Pfam:tRNA-synt_1 434 609 5.6e-8 PFAM
Pfam:tRNA-synt_1g 589 682 1.2e-6 PFAM
Pfam:tRNA-synt_1 633 678 1.6e-7 PFAM
Pfam:Anticodon_1 724 867 9.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217116
AA Change: L350P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Lars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Lars2 APN 9 123453248 missense probably damaging 0.98
IGL01993:Lars2 APN 9 123394943 splice site probably benign
IGL02155:Lars2 APN 9 123454982 missense probably damaging 0.99
IGL02941:Lars2 APN 9 123459585 missense probably damaging 0.97
IGL03090:Lars2 APN 9 123455960 missense probably damaging 1.00
IGL03271:Lars2 APN 9 123459484 splice site probably null
IGL03386:Lars2 APN 9 123453390 nonsense probably null
IGL03410:Lars2 APN 9 123418776 missense possibly damaging 0.87
ulrich UTSW 9 123418693 missense probably damaging 0.99
K3955:Lars2 UTSW 9 123377777 missense probably damaging 1.00
P0038:Lars2 UTSW 9 123377777 missense probably damaging 1.00
R0276:Lars2 UTSW 9 123438121 splice site probably benign
R1671:Lars2 UTSW 9 123418279 missense probably benign 0.02
R1829:Lars2 UTSW 9 123431917 missense probably benign 0.00
R2219:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R2220:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R4610:Lars2 UTSW 9 123418693 missense probably damaging 0.99
R5027:Lars2 UTSW 9 123441495 missense probably benign 0.38
R5195:Lars2 UTSW 9 123453310 missense probably damaging 0.97
R5597:Lars2 UTSW 9 123454982 missense probably damaging 0.99
R5756:Lars2 UTSW 9 123438199 missense probably damaging 1.00
R5783:Lars2 UTSW 9 123461596 missense probably benign
R6045:Lars2 UTSW 9 123371988 missense probably damaging 1.00
R6235:Lars2 UTSW 9 123411880 missense probably damaging 1.00
R6323:Lars2 UTSW 9 123441594 nonsense probably null
R6377:Lars2 UTSW 9 123454760 missense probably benign 0.00
R6395:Lars2 UTSW 9 123371925 missense probably benign 0.06
R7094:Lars2 UTSW 9 123459585 missense probably damaging 0.99
R7144:Lars2 UTSW 9 123431993 missense probably damaging 1.00
R7233:Lars2 UTSW 9 123411954 nonsense probably null
R7254:Lars2 UTSW 9 123454963 missense possibly damaging 0.93
R7413:Lars2 UTSW 9 123459503 missense probably benign 0.30
R7614:Lars2 UTSW 9 123395111 missense
R7683:Lars2 UTSW 9 123377830 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCACTGGTGTAAATTACCTGC -3'
(R):5'- TGATCCTCAGCTTCAAAGGG -3'

Sequencing Primer
(F):5'- TGCTAATACTCTTCAAAGGACCAG -3'
(R):5'- GTTTCACTGAGAAGCAAAACCC -3'
Posted On2019-09-13