Mutagenetix > Incidental Mutation

Incidental Mutation 'R7350:Cdh23'

570515

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin 23 (otocadherin)

Synonyms

nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.548) question?

Stock #

R7350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60302748-60696490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60410910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 916 (D916E)

Ref Sequence

ENSEMBL: ENSMUSP00000101101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000073242
AA Change: D916E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: D916E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105461
AA Change: D916E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: D916E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105462
AA Change: D919E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: D919E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105463
AA Change: D916E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: D916E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105464
AA Change: D914E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: D914E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	A	T	17: 25,946,711	V534D	probably damaging	Het
Abraxas2	T	C	7: 132,874,849	F106S	probably damaging	Het
Acsf3	A	G	8: 122,785,946	T369A	probably benign	Het
Adgrf5	G	A	17: 43,428,444		probably null	Het
Aff1	T	A	5: 103,847,092	I1052K	probably benign	Het
Akap8	T	C	17: 32,316,575	D155G	possibly damaging	Het
Alg10b	A	T	15: 90,227,450	M166L	probably benign	Het
Allc	T	A	12: 28,563,409	Q178L	possibly damaging	Het
Angptl4	C	A	17: 33,777,110	L297F	probably damaging	Het
Arfgap1	A	G	2: 180,971,076	K8E	possibly damaging	Het
Bckdhb	T	A	9: 84,010,326	V270E	possibly damaging	Het
Cbx3	T	C	6: 51,475,375		probably null	Het
Cd44	G	T	2: 102,834,262	N531K	probably benign	Het
Cr2	A	G	1: 195,155,286	V792A	probably benign	Het
Cstf3	T	C	2: 104,608,956	L38P	probably damaging	Het
Cyp2a5	A	G	7: 26,836,783	E151G	probably benign	Het
Dbr1	T	C	9: 99,582,549	F127S		Het
Ddit4	A	T	10: 59,951,495	D6E	probably damaging	Het
Disc1	G	C	8: 125,165,102	R631S	probably damaging	Het
Dnah5	T	A	15: 28,235,819		probably null	Het
Dnah9	T	C	11: 66,080,578	K1595E	probably damaging	Het
Dnmbp	T	C	19: 43,901,505	R608G	probably damaging	Het
Efcab5	G	C	11: 77,137,561	P315A	probably benign	Het
Eif4a2	A	G	16: 23,113,262	Y392C	possibly damaging	Het
F5	G	T	1: 164,192,708	K917N	probably benign	Het
Fig4	T	C	10: 41,251,756	M571V	probably benign	Het
Flot2	T	A	11: 78,057,976	I259N	probably damaging	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gpr152	T	C	19: 4,142,964	V168A	possibly damaging	Het
H1f0	G	A	15: 79,028,903	G61D	probably damaging	Het
Ihh	T	A	1: 74,948,333	K183M	probably damaging	Het
Itga2	A	G	13: 114,837,202	L1116P	probably damaging	Het
Kcnj10	A	G	1: 172,369,260	T114A	possibly damaging	Het
Kcnk3	T	G	5: 30,621,966	L120R	probably damaging	Het
Krt14	C	A	11: 100,205,100	E211*	probably null	Het
Lars2	T	C	9: 123,427,480	L350P	probably damaging	Het
Lrba	T	C	3: 86,351,902	I1408T	probably damaging	Het
Lrrc27	A	G	7: 139,226,106	E229G	probably benign	Het
Lrrc8e	G	T	8: 4,235,626	R617L	probably benign	Het
M1ap	A	G	6: 82,981,949	D187G	probably benign	Het
March1	A	T	8: 66,468,399	K243*	probably null	Het
Med16	C	T	10: 79,903,197	V252M	probably damaging	Het
Micu3	T	C	8: 40,348,958	S189P	probably benign	Het
Mier2	C	A	10: 79,540,298	M264I	unknown	Het
Mindy4	A	T	6: 55,301,025	N618I	probably damaging	Het
Mmrn1	C	T	6: 60,976,336	Q534*	probably null	Het
Mroh9	C	T	1: 163,076,289		probably null	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Mta3	T	A	17: 83,708,441	I24N	probably damaging	Het
Mtmr4	A	T	11: 87,600,650	H147L	probably damaging	Het
Nfam1	T	C	15: 83,010,439	K155R	probably benign	Het
Nlrp6	A	T	7: 140,921,278		probably benign	Het
Olfr1006	A	G	2: 85,674,845	F102S		Het
Olfr1153	T	C	2: 87,896,409		probably benign	Het
Olfr1164	A	T	2: 88,093,198	F246Y	probably benign	Het
Olfr213	A	G	6: 116,540,534	E27G	probably benign	Het
Olfr357	T	A	2: 36,996,861	I17N	possibly damaging	Het
P4ha1	A	G	10: 59,350,418	R240G	probably damaging	Het
Pla2r1	G	T	2: 60,458,379	D636E	probably benign	Het
Polr2a	A	G	11: 69,741,060	L1060P	possibly damaging	Het
Ptgdr2	C	A	19: 10,940,955	Q279K	probably benign	Het
Rab11fip2	T	A	19: 59,937,421	R121S	probably benign	Het
Rasa2	T	C	9: 96,544,355	S813G	probably benign	Het
Rassf5	T	C	1: 131,178,536	K411E	possibly damaging	Het
Reep4	T	C	14: 70,546,547	Y35H	probably damaging	Het
Ror1	A	T	4: 100,425,943	M402L	probably benign	Het
Slc32a1	A	G	2: 158,614,406	E327G	probably damaging	Het
Spen	C	T	4: 141,479,385	E644K	unknown	Het
Tarsl2	C	G	7: 65,658,924	Q281E	probably damaging	Het
Tcl1	A	G	12: 105,218,675	I92T	probably damaging	Het
Tifab	A	G	13: 56,176,307	S108P	probably damaging	Het
Traf1	T	C	2: 34,948,233	N198D	probably benign	Het
Trim35	T	C	14: 66,309,205	Y474H	probably damaging	Het
Trim54	T	A	5: 31,137,161	D344E	probably benign	Het
Ttc28	A	T	5: 111,226,037	H1113L	probably damaging	Het
Vcam1	T	A	3: 116,114,562	D617V	probably damaging	Het
Vmn2r81	A	T	10: 79,268,385	T281S	probably benign	Het
Whrn	C	T	4: 63,431,959	R507K	possibly damaging	Het
Zdhhc14	A	G	17: 5,726,876	S303G	probably benign	Het
Zfp292	A	T	4: 34,806,839	N2073K	probably benign	Het
Zgpat	T	A	2: 181,380,435	V163D		Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60523548	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60421141	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60307522	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60466097	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60312624	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60310787	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60385069	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60314694	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60409147	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60597725	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60331833	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60303513	missense	probably benign
IGL01767:Cdh23	APN	10	60315724	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60311137	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60419819	splice site	probably null
IGL02025:Cdh23	APN	10	60385143	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60523560	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60597765	splice site	probably benign
IGL02175:Cdh23	APN	10	60331308	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60305124	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60323523	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60465543	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60317942	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60385179	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60650122	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60465995	splice site	probably benign
IGL02626:Cdh23	APN	10	60391801	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60311364	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60376814	missense	probably damaging	0.99
dee_dee	UTSW	10	60308056	nonsense	probably null
hersey	UTSW	10	60308036	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60312624	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60314620	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60465458	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60413173	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60308056	nonsense	probably null
R0172:Cdh23	UTSW	10	60319632	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60317059	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60379315	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60410797	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60386946	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60316596	splice site	probably benign
R0545:Cdh23	UTSW	10	60331291	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60433777	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60307902	missense	probably damaging	0.99
R0647:Cdh23	UTSW	10	60323374	nonsense	probably null
R0730:Cdh23	UTSW	10	60323714	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60406421	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60410860	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60534510	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60331793	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60312392	splice site	probably benign
R1449:Cdh23	UTSW	10	60376951	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60487120	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60379343	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60314331	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60419699	splice site	probably benign
R1704:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60523536	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60326076	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60488542	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60391726	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60331281	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60323297	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60436818	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60323570	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60410873	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60385222	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60323582	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60314227	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60466043	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60596730	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60466004	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60323445	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60316724	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60307496	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60409010	splice site	probably benign
R3424:Cdh23	UTSW	10	60376881	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60410822	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60421040	splice site	probably null
R4273:Cdh23	UTSW	10	60311161	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60303493	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60385059	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60311086	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60534423	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60409044	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60337666	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60331350	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60409077	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60385038	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60419777	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60391784	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60376934	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60337851	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60307935	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60308032	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60304848	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60436807	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60312282	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60312572	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60657265	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60337762	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60314311	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60534386	splice site	probably null
R5673:Cdh23	UTSW	10	60307857	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60393023	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60407480	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60331317	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60305609	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60406392	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60306128	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60384934	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60428379	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60377821	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60392984	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60413577	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60307982	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60331326	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60465542	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60433758	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60434512	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60410821	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60426672	nonsense	probably null
R6302:Cdh23	UTSW	10	60305093	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60413151	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60438847	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60308036	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60331830	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60306168	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60378871	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60306122	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60487114	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60438856	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60650114	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60337306	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60530991	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60387044	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60307980	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60312599	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60331817	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60376841	missense	probably benign
R7335:Cdh23	UTSW	10	60305116	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60530996	missense	probably benign	0.19
R7366:Cdh23	UTSW	10	60315692	nonsense	probably null
R7374:Cdh23	UTSW	10	60317900	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60306224	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60384945	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60323550	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60407407	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60305152	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60337264	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60312577	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60385194	missense	probably benign	0.07
R7867:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R7878:Cdh23	UTSW	10	60314200	missense	possibly damaging	0.69
R7915:Cdh23	UTSW	10	60307889	missense	probably damaging	0.97
R7922:Cdh23	UTSW	10	60382706	missense	probably benign	0.31
R7963:Cdh23	UTSW	10	60336188	missense	probably damaging	1.00
R7997:Cdh23	UTSW	10	60596739	missense	possibly damaging	0.81
R8167:Cdh23	UTSW	10	60314383	missense	probably benign	0.12
R8167:Cdh23	UTSW	10	60337693	missense	probably damaging	0.96
R8258:Cdh23	UTSW	10	60315656	missense	probably damaging	0.99
R8259:Cdh23	UTSW	10	60315656	missense	probably damaging	0.99
R8317:Cdh23	UTSW	10	60311258	critical splice donor site	probably null
R8317:Cdh23	UTSW	10	60436789	missense	probably damaging	1.00
R8326:Cdh23	UTSW	10	60438812	missense	possibly damaging	0.55
R8333:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R8348:Cdh23	UTSW	10	60331728	missense	probably benign	0.43
R8366:Cdh23	UTSW	10	60325020	missense	probably benign
R8504:Cdh23	UTSW	10	60438839	missense	probably benign	0.00
R8676:Cdh23	UTSW	10	60410910	missense	probably damaging	1.00
R8781:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R8785:Cdh23	UTSW	10	60311335	missense	probably damaging	1.00
R8788:Cdh23	UTSW	10	60488593	missense	probably damaging	1.00
R8802:Cdh23	UTSW	10	60409098	missense	probably benign	0.04
R8837:Cdh23	UTSW	10	60324976	missense	probably benign	0.28
R8863:Cdh23	UTSW	10	60376834	nonsense	probably null
R8889:Cdh23	UTSW	10	60307505	missense	probably damaging	0.97
R8892:Cdh23	UTSW	10	60307505	missense	probably damaging	0.97
R8921:Cdh23	UTSW	10	60305129	missense	probably damaging	0.99
R8980:Cdh23	UTSW	10	60337846	missense	probably benign	0.06
R9000:Cdh23	UTSW	10	60304498	missense	possibly damaging	0.82
R9043:Cdh23	UTSW	10	60315699	missense	probably benign	0.00
R9046:Cdh23	UTSW	10	60382524	intron	probably benign
R9070:Cdh23	UTSW	10	60337760	missense	probably benign
R9075:Cdh23	UTSW	10	60317762	missense	probably damaging	1.00
R9132:Cdh23	UTSW	10	60434504	splice site	probably benign
R9155:Cdh23	UTSW	10	60413706	missense	probably damaging	0.99
R9171:Cdh23	UTSW	10	60326031	missense	probably benign	0.00
R9179:Cdh23	UTSW	10	60317885	missense	probably benign	0.06
R9186:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9189:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9207:Cdh23	UTSW	10	60407431	missense	probably damaging	1.00
R9240:Cdh23	UTSW	10	60379265	missense	probably benign	0.00
R9244:Cdh23	UTSW	10	60413663	missense	possibly damaging	0.93
R9284:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9286:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9287:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9302:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9352:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9353:Cdh23	UTSW	10	60307527	missense	possibly damaging	0.54
R9423:Cdh23	UTSW	10	60312608	missense	probably damaging	1.00
R9513:Cdh23	UTSW	10	60331216	missense	probably damaging	0.99
R9577:Cdh23	UTSW	10	60311116	missense	probably damaging	1.00
R9598:Cdh23	UTSW	10	60378795	missense	probably benign	0.01
R9631:Cdh23	UTSW	10	60407389	missense	possibly damaging	0.49
R9652:Cdh23	UTSW	10	60331356	missense	probably damaging	1.00
R9725:Cdh23	UTSW	10	60596782	missense	probably benign	0.02
X0052:Cdh23	UTSW	10	60385134	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60413644	missense	probably benign	0.35
Z1176:Cdh23	UTSW	10	60310770	missense	probably damaging	1.00
Z1176:Cdh23	UTSW	10	60428321	missense	probably benign
Z1177:Cdh23	UTSW	10	60323555	missense	possibly damaging	0.80
Z1177:Cdh23	UTSW	10	60434614	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGGTAGGTGTGCCAGCATC -3'
(R):5'- ATTTAGACTAGAGATCACCTGAGAGGC -3'

Sequencing Primer
(F):5'- GCATCGCTGGCCACCAC -3'
(R):5'- AGCTCTGATACCCTACTAAGTGTGG -3'

Posted On

2019-09-13