Incidental Mutation 'R7350:Tcl1'
ID 570526
Institutional Source Beutler Lab
Gene Symbol Tcl1
Ensembl Gene ENSMUSG00000041359
Gene Name T cell lymphoma breakpoint 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R7350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 105216750-105222793 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105218675 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 92 (I92T)
Ref Sequence ENSEMBL: ENSMUSP00000098632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041316] [ENSMUST00000101071] [ENSMUST00000175652] [ENSMUST00000176579] [ENSMUST00000177521]
AlphaFold P56280
Predicted Effect probably damaging
Transcript: ENSMUST00000041316
AA Change: I92T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036066
Gene: ENSMUSG00000041359
AA Change: I92T

DomainStartEndE-ValueType
Pfam:TCL1_MTCP1 1 111 2.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101071
AA Change: I92T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098632
Gene: ENSMUSG00000041359
AA Change: I92T

DomainStartEndE-ValueType
Pfam:TCL1_MTCP1 1 104 7.6e-39 PFAM
low complexity region 142 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175652
SMART Domains Protein: ENSMUSP00000134811
Gene: ENSMUSG00000041359

DomainStartEndE-ValueType
Pfam:TCL1_MTCP1 1 46 2.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176579
SMART Domains Protein: ENSMUSP00000135069
Gene: ENSMUSG00000041359

DomainStartEndE-ValueType
Pfam:TCL1_MTCP1 1 87 6.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177521
AA Change: I92T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134903
Gene: ENSMUSG00000041359
AA Change: I92T

DomainStartEndE-ValueType
Pfam:TCL1_MTCP1 1 101 3.7e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Overexpression of the TCL1 gene in humans has been implicated in the development of mature T cell leukemia, in which chromosomal rearrangements bring the TCL1 gene in close proximity to the T-cell antigen receptor (TCR)-alpha (MIM 186880) or TCR-beta (MIM 186930) regulatory elements (summarized by Virgilio et al., 1998 [PubMed 9520462]). In normal T cells TCL1 is expressed in CD4-/CD8- cells, but not in cells at later stages of differentiation. TCL1 functions as a coactivator of the cell survival kinase AKT (MIM 164730) (Laine et al., 2000 [PubMed 10983986]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a maternal fertility defect that leads to a progressive reduction in litter size and a shortened reproductive lifespan. Reduced female fertility is caused by impaired blastomere proliferation in the early preimplantation embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Tcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02413:Tcl1 APN 12 105218823 nonsense probably null
R0726:Tcl1 UTSW 12 105218670 missense probably damaging 0.99
R4586:Tcl1 UTSW 12 105217508 unclassified probably benign
R4931:Tcl1 UTSW 12 105222613 missense probably damaging 1.00
R6924:Tcl1 UTSW 12 105218756 missense probably damaging 1.00
R7036:Tcl1 UTSW 12 105217601 utr 3 prime probably benign
R8926:Tcl1 UTSW 12 105218710 intron probably benign
R9340:Tcl1 UTSW 12 105218720 missense probably damaging 1.00
Z1176:Tcl1 UTSW 12 105217481 missense unknown
Z1176:Tcl1 UTSW 12 105217551 missense unknown
Z1177:Tcl1 UTSW 12 105218812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTTTGGCTAAGACCTTAG -3'
(R):5'- AGGAGGCAAAGGTTGTGTTC -3'

Sequencing Primer
(F):5'- GCTAAGACCTTAGATGATGGCTTC -3'
(R):5'- CTGTTCTTCCTCTGCAGAGTAATG -3'
Posted On 2019-09-13