Incidental Mutation 'R7350:Itga2'
ID 570528
Institutional Source Beutler Lab
Gene Symbol Itga2
Ensembl Gene ENSMUSG00000015533
Gene Name integrin alpha 2
Synonyms VLA-2 receptor, alpha 2 subunit, DX5, CD49B
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 114833081-114932100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114837202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1116 (L1116P)
Ref Sequence ENSEMBL: ENSMUSP00000053891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056117] [ENSMUST00000184245]
AlphaFold Q62469
Predicted Effect probably damaging
Transcript: ENSMUST00000056117
AA Change: L1116P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: L1116P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Int_alpha 41 96 4.91e-4 SMART
VWA 169 359 2.42e-39 SMART
Blast:VWA 364 424 4e-26 BLAST
Int_alpha 430 481 2.59e-3 SMART
Int_alpha 484 541 3.5e-9 SMART
Int_alpha 547 602 3.11e-15 SMART
Int_alpha 611 669 2.52e-1 SMART
low complexity region 890 910 N/A INTRINSIC
transmembrane domain 1129 1151 N/A INTRINSIC
Pfam:Integrin_alpha 1152 1166 9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184245
SMART Domains Protein: ENSMUSP00000139355
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Itga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Itga2 APN 13 114877625 missense probably damaging 0.99
IGL01481:Itga2 APN 13 114859632 missense possibly damaging 0.63
IGL01666:Itga2 APN 13 114837091 critical splice donor site probably null
IGL01730:Itga2 APN 13 114854411 splice site probably benign
IGL01965:Itga2 APN 13 114848064 splice site probably benign
IGL01987:Itga2 APN 13 114847946 nonsense probably null
IGL02334:Itga2 APN 13 114865309 critical splice donor site probably null
IGL02381:Itga2 APN 13 114856722 missense probably damaging 1.00
IGL02562:Itga2 APN 13 114836570 unclassified probably benign
IGL03191:Itga2 APN 13 114836484 unclassified probably benign
IGL03209:Itga2 APN 13 114880632 missense probably damaging 1.00
P0007:Itga2 UTSW 13 114866199 missense probably damaging 1.00
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0025:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0029:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0149:Itga2 UTSW 13 114836579 unclassified probably benign
R0152:Itga2 UTSW 13 114866314 missense probably benign 0.06
R0496:Itga2 UTSW 13 114853899 missense probably benign 0.00
R0502:Itga2 UTSW 13 114845856 missense probably benign 0.15
R0599:Itga2 UTSW 13 114856650 splice site probably benign
R0688:Itga2 UTSW 13 114839554 missense probably benign 0.00
R0704:Itga2 UTSW 13 114862375 missense possibly damaging 0.91
R0760:Itga2 UTSW 13 114859632 missense possibly damaging 0.63
R0811:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0812:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0836:Itga2 UTSW 13 114856679 missense probably damaging 0.99
R1196:Itga2 UTSW 13 114866155 critical splice donor site probably null
R1546:Itga2 UTSW 13 114849420 missense possibly damaging 0.63
R1639:Itga2 UTSW 13 114857296 missense probably benign 0.00
R1834:Itga2 UTSW 13 114856726 missense probably damaging 0.98
R1834:Itga2 UTSW 13 114856727 missense probably damaging 1.00
R2180:Itga2 UTSW 13 114849381 missense possibly damaging 0.67
R2190:Itga2 UTSW 13 114870605 missense probably benign 0.05
R2518:Itga2 UTSW 13 114881042 missense probably damaging 1.00
R3885:Itga2 UTSW 13 114869299 missense probably benign 0.35
R3962:Itga2 UTSW 13 114839518 missense probably damaging 0.99
R4094:Itga2 UTSW 13 114870625 missense probably benign 0.01
R4193:Itga2 UTSW 13 114886649 nonsense probably null
R4290:Itga2 UTSW 13 114866173 missense probably damaging 0.98
R4459:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4460:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4628:Itga2 UTSW 13 114877693 missense probably benign 0.03
R4655:Itga2 UTSW 13 114873269 missense probably benign 0.00
R4716:Itga2 UTSW 13 114857373 missense probably damaging 0.98
R4896:Itga2 UTSW 13 114853766 nonsense probably null
R5093:Itga2 UTSW 13 114856181 missense probably benign 0.00
R5488:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5489:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5743:Itga2 UTSW 13 114884506 missense probably damaging 1.00
R5767:Itga2 UTSW 13 114839570 missense possibly damaging 0.88
R5790:Itga2 UTSW 13 114868206 missense probably benign 0.02
R5923:Itga2 UTSW 13 114884519 missense probably benign 0.02
R6163:Itga2 UTSW 13 114866190 missense probably damaging 1.00
R6227:Itga2 UTSW 13 114839561 missense probably benign 0.30
R6278:Itga2 UTSW 13 114845888 missense probably benign 0.05
R6283:Itga2 UTSW 13 114869250 missense probably damaging 1.00
R6332:Itga2 UTSW 13 114843473 missense probably benign
R6510:Itga2 UTSW 13 114873280 missense probably damaging 1.00
R6742:Itga2 UTSW 13 114836525 missense possibly damaging 0.93
R6869:Itga2 UTSW 13 114875537 splice site probably null
R7073:Itga2 UTSW 13 114859613 missense probably damaging 1.00
R7111:Itga2 UTSW 13 114900530 missense unknown
R7236:Itga2 UTSW 13 114877691 missense probably benign
R7269:Itga2 UTSW 13 114886689 nonsense probably null
R7296:Itga2 UTSW 13 114857394 splice site probably null
R7375:Itga2 UTSW 13 114869217 missense probably benign 0.06
R7501:Itga2 UTSW 13 114875559 missense probably damaging 1.00
R7687:Itga2 UTSW 13 114866260 missense probably damaging 1.00
R7766:Itga2 UTSW 13 114853891 missense probably benign
R7810:Itga2 UTSW 13 114866179 missense probably benign 0.15
R8038:Itga2 UTSW 13 114853755 missense probably damaging 1.00
R8948:Itga2 UTSW 13 114873330 missense probably damaging 1.00
R9132:Itga2 UTSW 13 114877762 nonsense probably null
R9153:Itga2 UTSW 13 114865405 missense probably benign 0.00
R9159:Itga2 UTSW 13 114877762 nonsense probably null
R9651:Itga2 UTSW 13 114884455 missense probably benign 0.00
R9652:Itga2 UTSW 13 114884455 missense probably benign 0.00
R9653:Itga2 UTSW 13 114884455 missense probably benign 0.00
Z1088:Itga2 UTSW 13 114857332 missense possibly damaging 0.46
Z1177:Itga2 UTSW 13 114853701 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTATGCCGTGTTCAGGTTG -3'
(R):5'- TAGAAAGGCTGTGCTTCCCTG -3'

Sequencing Primer
(F):5'- GGTATTTTGTAGGGAATTCAAAACAG -3'
(R):5'- TCCCTGGGTTTTCAGATTGTC -3'
Posted On 2019-09-13