Incidental Mutation 'R7350:Akap8'
ID 570539
Institutional Source Beutler Lab
Gene Symbol Akap8
Ensembl Gene ENSMUSG00000024045
Gene Name A kinase anchor protein 8
Synonyms AKAP95, 1200016A02Rik
MMRRC Submission 045436-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 32522646-32540212 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32535549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 155 (D155G)
Ref Sequence ENSEMBL: ENSMUSP00000002699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002699] [ENSMUST00000050214]
AlphaFold Q9DBR0
Predicted Effect possibly damaging
Transcript: ENSMUST00000002699
AA Change: D155G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045
AA Change: D155G

DomainStartEndE-ValueType
SCOP:d1a0tp_ 12 108 3e-19 SMART
low complexity region 183 198 N/A INTRINSIC
low complexity region 257 270 N/A INTRINSIC
low complexity region 354 384 N/A INTRINSIC
ZnF_C2H2 387 411 9.46e0 SMART
Blast:ZnF_C2H2 476 501 9e-9 BLAST
low complexity region 551 582 N/A INTRINSIC
low complexity region 642 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050214
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the A-kinase anchoring protein (AKAP) family. These proteins are characterized by their ability to bind to the R subunit of protein kinase A (PKA) and anchor the protein at different subcellular locations. This protein has been shown to regulate apoptosis and to be involved in palatogenesis. Knockdown of this gene has been associated with altered histone modifications and reduced expression of developmental genes in mouse embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 T C 7: 132,476,578 (GRCm39) F106S probably damaging Het
Acsf3 A G 8: 123,512,685 (GRCm39) T369A probably benign Het
Adgrf5 G A 17: 43,739,335 (GRCm39) probably null Het
Aff1 T A 5: 103,994,958 (GRCm39) I1052K probably benign Het
Alg10b A T 15: 90,111,653 (GRCm39) M166L probably benign Het
Allc T A 12: 28,613,408 (GRCm39) Q178L possibly damaging Het
Angptl4 C A 17: 33,996,084 (GRCm39) L297F probably damaging Het
Arfgap1 A G 2: 180,612,869 (GRCm39) K8E possibly damaging Het
Bckdhb T A 9: 83,892,379 (GRCm39) V270E possibly damaging Het
Cbx3 T C 6: 51,452,355 (GRCm39) probably null Het
Cd44 G T 2: 102,664,607 (GRCm39) N531K probably benign Het
Cdh23 A T 10: 60,246,689 (GRCm39) D916E probably damaging Het
Cr2 A G 1: 194,837,594 (GRCm39) V792A probably benign Het
Cstf3 T C 2: 104,439,301 (GRCm39) L38P probably damaging Het
Cyp2a5 A G 7: 26,536,208 (GRCm39) E151G probably benign Het
Dbr1 T C 9: 99,464,602 (GRCm39) F127S Het
Ddit4 A T 10: 59,787,317 (GRCm39) D6E probably damaging Het
Disc1 G C 8: 125,891,841 (GRCm39) R631S probably damaging Het
Dnah5 T A 15: 28,235,965 (GRCm39) probably null Het
Dnah9 T C 11: 65,971,404 (GRCm39) K1595E probably damaging Het
Dnmbp T C 19: 43,889,944 (GRCm39) R608G probably damaging Het
Efcab5 G C 11: 77,028,387 (GRCm39) P315A probably benign Het
Eif4a2 A G 16: 22,932,012 (GRCm39) Y392C possibly damaging Het
F5 G T 1: 164,020,277 (GRCm39) K917N probably benign Het
Fig4 T C 10: 41,127,752 (GRCm39) M571V probably benign Het
Flot2 T A 11: 77,948,802 (GRCm39) I259N probably damaging Het
Gm8122 C A 14: 43,088,058 (GRCm39) probably null Het
Gpr152 T C 19: 4,192,963 (GRCm39) V168A possibly damaging Het
H1f0 G A 15: 78,913,103 (GRCm39) G61D probably damaging Het
Ihh T A 1: 74,987,492 (GRCm39) K183M probably damaging Het
Itga2 A G 13: 114,973,738 (GRCm39) L1116P probably damaging Het
Kcnj10 A G 1: 172,196,827 (GRCm39) T114A possibly damaging Het
Kcnk3 T G 5: 30,779,310 (GRCm39) L120R probably damaging Het
Krt14 C A 11: 100,095,926 (GRCm39) E211* probably null Het
Lars2 T C 9: 123,256,545 (GRCm39) L350P probably damaging Het
Lrba T C 3: 86,259,209 (GRCm39) I1408T probably damaging Het
Lrrc27 A G 7: 138,806,022 (GRCm39) E229G probably benign Het
Lrrc8e G T 8: 4,285,626 (GRCm39) R617L probably benign Het
M1ap A G 6: 82,958,930 (GRCm39) D187G probably benign Het
Marchf1 A T 8: 66,921,051 (GRCm39) K243* probably null Het
Med16 C T 10: 79,739,031 (GRCm39) V252M probably damaging Het
Micu3 T C 8: 40,801,999 (GRCm39) S189P probably benign Het
Mier2 C A 10: 79,376,132 (GRCm39) M264I unknown Het
Mindy4 A T 6: 55,278,010 (GRCm39) N618I probably damaging Het
Mmrn1 C T 6: 60,953,320 (GRCm39) Q534* probably null Het
Mroh9 C T 1: 162,903,858 (GRCm39) probably null Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Mta3 T A 17: 84,015,870 (GRCm39) I24N probably damaging Het
Mtmr4 A T 11: 87,491,476 (GRCm39) H147L probably damaging Het
Nfam1 T C 15: 82,894,640 (GRCm39) K155R probably benign Het
Nlrp6 A T 7: 140,501,191 (GRCm39) probably benign Het
Or1q1 T A 2: 36,886,873 (GRCm39) I17N possibly damaging Het
Or5d37 A T 2: 87,923,542 (GRCm39) F246Y probably benign Het
Or5w20 T C 2: 87,726,753 (GRCm39) probably benign Het
Or6d13 A G 6: 116,517,495 (GRCm39) E27G probably benign Het
Or9g4 A G 2: 85,505,189 (GRCm39) F102S Het
P4ha1 A G 10: 59,186,240 (GRCm39) R240G probably damaging Het
Pla2r1 G T 2: 60,288,723 (GRCm39) D636E probably benign Het
Polr2a A G 11: 69,631,886 (GRCm39) L1060P possibly damaging Het
Prr35 A T 17: 26,165,685 (GRCm39) V534D probably damaging Het
Ptgdr2 C A 19: 10,918,319 (GRCm39) Q279K probably benign Het
Rab11fip2 T A 19: 59,925,853 (GRCm39) R121S probably benign Het
Rasa2 T C 9: 96,426,408 (GRCm39) S813G probably benign Het
Rassf5 T C 1: 131,106,273 (GRCm39) K411E possibly damaging Het
Reep4 T C 14: 70,783,987 (GRCm39) Y35H probably damaging Het
Ror1 A T 4: 100,283,140 (GRCm39) M402L probably benign Het
Slc32a1 A G 2: 158,456,326 (GRCm39) E327G probably damaging Het
Spen C T 4: 141,206,696 (GRCm39) E644K unknown Het
Tars3 C G 7: 65,308,672 (GRCm39) Q281E probably damaging Het
Tcl1 A G 12: 105,184,934 (GRCm39) I92T probably damaging Het
Tifab A G 13: 56,324,120 (GRCm39) S108P probably damaging Het
Traf1 T C 2: 34,838,245 (GRCm39) N198D probably benign Het
Trim35 T C 14: 66,546,654 (GRCm39) Y474H probably damaging Het
Trim54 T A 5: 31,294,505 (GRCm39) D344E probably benign Het
Ttc28 A T 5: 111,373,903 (GRCm39) H1113L probably damaging Het
Vcam1 T A 3: 115,908,211 (GRCm39) D617V probably damaging Het
Vmn2r81 A T 10: 79,104,219 (GRCm39) T281S probably benign Het
Whrn C T 4: 63,350,196 (GRCm39) R507K possibly damaging Het
Zdhhc14 A G 17: 5,777,151 (GRCm39) S303G probably benign Het
Zfp292 A T 4: 34,806,839 (GRCm39) N2073K probably benign Het
Zgpat T A 2: 181,022,228 (GRCm39) V163D Het
Other mutations in Akap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Akap8 APN 17 32,536,254 (GRCm39) missense probably damaging 1.00
IGL01450:Akap8 APN 17 32,534,661 (GRCm39) missense probably damaging 1.00
IGL02002:Akap8 APN 17 32,528,470 (GRCm39) missense probably damaging 1.00
IGL02223:Akap8 APN 17 32,535,621 (GRCm39) missense probably damaging 1.00
IGL02315:Akap8 APN 17 32,524,475 (GRCm39) missense probably benign 0.01
IGL03404:Akap8 APN 17 32,531,250 (GRCm39) splice site probably benign
BB006:Akap8 UTSW 17 32,528,419 (GRCm39) missense probably damaging 1.00
BB016:Akap8 UTSW 17 32,528,419 (GRCm39) missense probably damaging 1.00
R0310:Akap8 UTSW 17 32,535,234 (GRCm39) missense possibly damaging 0.81
R0526:Akap8 UTSW 17 32,536,266 (GRCm39) missense probably benign 0.28
R1795:Akap8 UTSW 17 32,534,451 (GRCm39) missense probably damaging 1.00
R1992:Akap8 UTSW 17 32,535,586 (GRCm39) missense probably damaging 0.99
R2571:Akap8 UTSW 17 32,534,429 (GRCm39) missense probably damaging 1.00
R2918:Akap8 UTSW 17 32,524,622 (GRCm39) missense probably benign 0.01
R3423:Akap8 UTSW 17 32,535,429 (GRCm39) missense possibly damaging 0.61
R3870:Akap8 UTSW 17 32,536,813 (GRCm39) unclassified probably benign
R4077:Akap8 UTSW 17 32,531,272 (GRCm39) missense probably damaging 1.00
R4078:Akap8 UTSW 17 32,531,272 (GRCm39) missense probably damaging 1.00
R4379:Akap8 UTSW 17 32,525,534 (GRCm39) missense probably damaging 0.99
R4756:Akap8 UTSW 17 32,535,184 (GRCm39) missense probably damaging 0.98
R4819:Akap8 UTSW 17 32,531,279 (GRCm39) missense probably damaging 1.00
R5091:Akap8 UTSW 17 32,535,208 (GRCm39) missense probably benign 0.05
R5761:Akap8 UTSW 17 32,536,159 (GRCm39) missense possibly damaging 0.56
R6896:Akap8 UTSW 17 32,536,305 (GRCm39) missense probably benign 0.00
R7138:Akap8 UTSW 17 32,535,515 (GRCm39) missense possibly damaging 0.86
R7929:Akap8 UTSW 17 32,528,419 (GRCm39) missense probably damaging 1.00
R8693:Akap8 UTSW 17 32,529,625 (GRCm39) missense probably damaging 1.00
R8810:Akap8 UTSW 17 32,525,504 (GRCm39) missense probably damaging 1.00
R9521:Akap8 UTSW 17 32,530,036 (GRCm39) missense possibly damaging 0.89
X0020:Akap8 UTSW 17 32,534,724 (GRCm39) missense probably benign 0.08
Z1176:Akap8 UTSW 17 32,525,523 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGAAAGGGTCACTACG -3'
(R):5'- GCATTTAGGTAGATACTGACTGGG -3'

Sequencing Primer
(F):5'- GGTCACTACGTATGAAGGTGC -3'
(R):5'- GGTCCAACTTAGTGTAAAGTTAGGC -3'
Posted On 2019-09-13