Mutagenetix > Incidental Mutation

Incidental Mutation 'R7350:Ms4a6d'

570545

Institutional Source

Beutler Lab

Gene Symbol

Ms4a6d

Ensembl Gene

ENSMUSG00000024679

Gene Name

membrane-spanning 4-domains, subfamily A, member 6D

Synonyms

Ms4a11

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R7350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11586604-11604849 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 11590073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 155 (Q155*)

Ref Sequence

ENSEMBL: ENSMUSP00000025582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025582] [ENSMUST00000125291]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000025582
AA Change: Q155*

SMART Domains

Protein: ENSMUSP00000025582
Gene: ENSMUSG00000024679
AA Change: Q155*

Domain	Start	End	E-Value	Type
Pfam:CD20	47	207	2.8e-42	PFAM
low complexity region	222	235	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000125291
AA Change: Q47*

SMART Domains

Protein: ENSMUSP00000115142
Gene: ENSMUSG00000024679
AA Change: Q47*

Domain	Start	End	E-Value	Type
Pfam:CD20	1	99	3.7e-15	PFAM
low complexity region	114	127	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	A	T	17: 25,946,711	V534D	probably damaging	Het
Abraxas2	T	C	7: 132,874,849	F106S	probably damaging	Het
Acsf3	A	G	8: 122,785,946	T369A	probably benign	Het
Adgrf5	G	A	17: 43,428,444		probably null	Het
Aff1	T	A	5: 103,847,092	I1052K	probably benign	Het
Akap8	T	C	17: 32,316,575	D155G	possibly damaging	Het
Alg10b	A	T	15: 90,227,450	M166L	probably benign	Het
Allc	T	A	12: 28,563,409	Q178L	possibly damaging	Het
Angptl4	C	A	17: 33,777,110	L297F	probably damaging	Het
Arfgap1	A	G	2: 180,971,076	K8E	possibly damaging	Het
Bckdhb	T	A	9: 84,010,326	V270E	possibly damaging	Het
Cbx3	T	C	6: 51,475,375		probably null	Het
Cd44	G	T	2: 102,834,262	N531K	probably benign	Het
Cdh23	A	T	10: 60,410,910	D916E	probably damaging	Het
Cr2	A	G	1: 195,155,286	V792A	probably benign	Het
Cstf3	T	C	2: 104,608,956	L38P	probably damaging	Het
Cyp2a5	A	G	7: 26,836,783	E151G	probably benign	Het
Dbr1	T	C	9: 99,582,549	F127S		Het
Ddit4	A	T	10: 59,951,495	D6E	probably damaging	Het
Disc1	G	C	8: 125,165,102	R631S	probably damaging	Het
Dnah5	T	A	15: 28,235,819		probably null	Het
Dnah9	T	C	11: 66,080,578	K1595E	probably damaging	Het
Dnmbp	T	C	19: 43,901,505	R608G	probably damaging	Het
Efcab5	G	C	11: 77,137,561	P315A	probably benign	Het
Eif4a2	A	G	16: 23,113,262	Y392C	possibly damaging	Het
F5	G	T	1: 164,192,708	K917N	probably benign	Het
Fig4	T	C	10: 41,251,756	M571V	probably benign	Het
Flot2	T	A	11: 78,057,976	I259N	probably damaging	Het
Gm8122	C	A	14: 43,230,601		probably null	Het
Gpr152	T	C	19: 4,142,964	V168A	possibly damaging	Het
H1f0	G	A	15: 79,028,903	G61D	probably damaging	Het
Ihh	T	A	1: 74,948,333	K183M	probably damaging	Het
Itga2	A	G	13: 114,837,202	L1116P	probably damaging	Het
Kcnj10	A	G	1: 172,369,260	T114A	possibly damaging	Het
Kcnk3	T	G	5: 30,621,966	L120R	probably damaging	Het
Krt14	C	A	11: 100,205,100	E211*	probably null	Het
Lars2	T	C	9: 123,427,480	L350P	probably damaging	Het
Lrba	T	C	3: 86,351,902	I1408T	probably damaging	Het
Lrrc27	A	G	7: 139,226,106	E229G	probably benign	Het
Lrrc8e	G	T	8: 4,235,626	R617L	probably benign	Het
M1ap	A	G	6: 82,981,949	D187G	probably benign	Het
March1	A	T	8: 66,468,399	K243*	probably null	Het
Med16	C	T	10: 79,903,197	V252M	probably damaging	Het
Micu3	T	C	8: 40,348,958	S189P	probably benign	Het
Mier2	C	A	10: 79,540,298	M264I	unknown	Het
Mindy4	A	T	6: 55,301,025	N618I	probably damaging	Het
Mmrn1	C	T	6: 60,976,336	Q534*	probably null	Het
Mroh9	C	T	1: 163,076,289		probably null	Het
Mta3	T	A	17: 83,708,441	I24N	probably damaging	Het
Mtmr4	A	T	11: 87,600,650	H147L	probably damaging	Het
Nfam1	T	C	15: 83,010,439	K155R	probably benign	Het
Nlrp6	A	T	7: 140,921,278		probably benign	Het
Olfr1006	A	G	2: 85,674,845	F102S		Het
Olfr1153	T	C	2: 87,896,409		probably benign	Het
Olfr1164	A	T	2: 88,093,198	F246Y	probably benign	Het
Olfr213	A	G	6: 116,540,534	E27G	probably benign	Het
Olfr357	T	A	2: 36,996,861	I17N	possibly damaging	Het
P4ha1	A	G	10: 59,350,418	R240G	probably damaging	Het
Pla2r1	G	T	2: 60,458,379	D636E	probably benign	Het
Polr2a	A	G	11: 69,741,060	L1060P	possibly damaging	Het
Ptgdr2	C	A	19: 10,940,955	Q279K	probably benign	Het
Rab11fip2	T	A	19: 59,937,421	R121S	probably benign	Het
Rasa2	T	C	9: 96,544,355	S813G	probably benign	Het
Rassf5	T	C	1: 131,178,536	K411E	possibly damaging	Het
Reep4	T	C	14: 70,546,547	Y35H	probably damaging	Het
Ror1	A	T	4: 100,425,943	M402L	probably benign	Het
Slc32a1	A	G	2: 158,614,406	E327G	probably damaging	Het
Spen	C	T	4: 141,479,385	E644K	unknown	Het
Tarsl2	C	G	7: 65,658,924	Q281E	probably damaging	Het
Tcl1	A	G	12: 105,218,675	I92T	probably damaging	Het
Tifab	A	G	13: 56,176,307	S108P	probably damaging	Het
Traf1	T	C	2: 34,948,233	N198D	probably benign	Het
Trim35	T	C	14: 66,309,205	Y474H	probably damaging	Het
Trim54	T	A	5: 31,137,161	D344E	probably benign	Het
Ttc28	A	T	5: 111,226,037	H1113L	probably damaging	Het
Vcam1	T	A	3: 116,114,562	D617V	probably damaging	Het
Vmn2r81	A	T	10: 79,268,385	T281S	probably benign	Het
Whrn	C	T	4: 63,431,959	R507K	possibly damaging	Het
Zdhhc14	A	G	17: 5,726,876	S303G	probably benign	Het
Zfp292	A	T	4: 34,806,839	N2073K	probably benign	Het
Zgpat	T	A	2: 181,380,435	V163D		Het

Other mutations in Ms4a6d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Ms4a6d	APN	19	11601885	missense	probably damaging	0.99
IGL01638:Ms4a6d	APN	19	11587168	missense	probably damaging	0.99
IGL01799:Ms4a6d	APN	19	11590135	missense	probably damaging	1.00
IGL02304:Ms4a6d	APN	19	11603141	splice site	probably benign
R1873:Ms4a6d	UTSW	19	11601859	missense	probably damaging	1.00
R1993:Ms4a6d	UTSW	19	11590159	missense	probably damaging	1.00
R2443:Ms4a6d	UTSW	19	11590193	missense	possibly damaging	0.93
R2900:Ms4a6d	UTSW	19	11590144	missense	probably damaging	1.00
R5288:Ms4a6d	UTSW	19	11587136	missense	possibly damaging	0.78
R6251:Ms4a6d	UTSW	19	11587140	missense	probably damaging	0.99
R7339:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7340:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7341:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7342:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7347:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7348:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7368:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7393:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R7394:Ms4a6d	UTSW	19	11590073	nonsense	probably null
R8020:Ms4a6d	UTSW	19	11590108	missense	probably benign	0.00
R8181:Ms4a6d	UTSW	19	11603289	missense	probably damaging	0.99
R8785:Ms4a6d	UTSW	19	11593036	critical splice donor site	probably benign
R9262:Ms4a6d	UTSW	19	11601852	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGAACAGAGTTTTGAATCAGGGAAC -3'
(R):5'- GCAGACACTAGAGGGCATTG -3'

Sequencing Primer
(F):5'- TCAGGGAACAGAAGAAATATGCTGTC -3'
(R):5'- CAAGCAGCTGGGCCTATTATAGTG -3'

Posted On

2019-09-13