Incidental Mutation 'R7351:Hmcn1'
ID 570548
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms EG545370, LOC240793
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 150438275-150869186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150543640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 2845 (Y2845F)
Ref Sequence ENSEMBL: ENSMUSP00000074340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074783
AA Change: Y2845F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: Y2845F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137197
AA Change: Y2845F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: Y2845F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,553,029 (GRCm39) missense probably benign
IGL00571:Hmcn1 APN 1 150,514,750 (GRCm39) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,682,117 (GRCm39) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,540,687 (GRCm39) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,532,485 (GRCm39) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,506,091 (GRCm39) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,486,464 (GRCm39) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,480,757 (GRCm39) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,458,052 (GRCm39) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,514,620 (GRCm39) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,502,784 (GRCm39) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,508,303 (GRCm39) splice site probably benign
IGL01304:Hmcn1 APN 1 150,498,675 (GRCm39) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,620,752 (GRCm39) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,594,991 (GRCm39) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,468,848 (GRCm39) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,734,990 (GRCm39) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,480,823 (GRCm39) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,485,382 (GRCm39) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,474,148 (GRCm39) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,503,164 (GRCm39) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,547,783 (GRCm39) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,455,984 (GRCm39) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,613,050 (GRCm39) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,459,031 (GRCm39) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,620,711 (GRCm39) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,547,789 (GRCm39) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,491,051 (GRCm39) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,566,352 (GRCm39) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,618,011 (GRCm39) splice site probably benign
IGL01906:Hmcn1 APN 1 150,543,638 (GRCm39) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,608,643 (GRCm39) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,479,622 (GRCm39) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,491,049 (GRCm39) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,579,932 (GRCm39) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,506,479 (GRCm39) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,598,358 (GRCm39) missense probably benign
IGL02155:Hmcn1 APN 1 150,439,349 (GRCm39) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,682,152 (GRCm39) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,540,666 (GRCm39) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,678,648 (GRCm39) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,598,175 (GRCm39) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,868,774 (GRCm39) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,685,477 (GRCm39) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,573,244 (GRCm39) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,620,746 (GRCm39) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,494,760 (GRCm39) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,480,654 (GRCm39) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,532,445 (GRCm39) nonsense probably null
IGL02735:Hmcn1 APN 1 150,522,583 (GRCm39) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,439,579 (GRCm39) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,551,725 (GRCm39) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,453,029 (GRCm39) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,532,958 (GRCm39) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,573,273 (GRCm39) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,547,668 (GRCm39) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,684,290 (GRCm39) missense probably benign
IGL03195:Hmcn1 APN 1 150,678,660 (GRCm39) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,619,418 (GRCm39) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,646,103 (GRCm39) splice site probably benign
IGL03268:Hmcn1 APN 1 150,648,261 (GRCm39) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,474,175 (GRCm39) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,505,982 (GRCm39) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,608,661 (GRCm39) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,577,720 (GRCm39) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,539,623 (GRCm39) missense probably damaging 1.00
Backbone UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
Cambrian UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
chordate UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
Justamere UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
Lancelet UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
notochord UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
wippoorwill UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,614,409 (GRCm39) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,596,440 (GRCm39) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,684,488 (GRCm39) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,545,238 (GRCm39) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,684,427 (GRCm39) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,528,302 (GRCm39) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,553,157 (GRCm39) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,684,398 (GRCm39) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,553,075 (GRCm39) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,539,630 (GRCm39) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,479,562 (GRCm39) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,674,565 (GRCm39) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,591,573 (GRCm39) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,608,543 (GRCm39) splice site probably benign
R0503:Hmcn1 UTSW 1 150,735,003 (GRCm39) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,752,170 (GRCm39) splice site probably benign
R0506:Hmcn1 UTSW 1 150,618,092 (GRCm39) missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150,594,868 (GRCm39) missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150,525,768 (GRCm39) nonsense probably null
R0599:Hmcn1 UTSW 1 150,485,552 (GRCm39) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,533,127 (GRCm39) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,469,767 (GRCm39) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,674,470 (GRCm39) splice site probably null
R0699:Hmcn1 UTSW 1 150,695,161 (GRCm39) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,684,538 (GRCm39) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,629,416 (GRCm39) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,525,824 (GRCm39) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R0975:Hmcn1 UTSW 1 150,453,128 (GRCm39) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1233:Hmcn1 UTSW 1 150,624,777 (GRCm39) missense probably benign
R1234:Hmcn1 UTSW 1 150,629,405 (GRCm39) nonsense probably null
R1291:Hmcn1 UTSW 1 150,623,942 (GRCm39) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,556,466 (GRCm39) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,522,545 (GRCm39) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,528,257 (GRCm39) splice site probably benign
R1458:Hmcn1 UTSW 1 150,485,451 (GRCm39) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,648,303 (GRCm39) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,545,172 (GRCm39) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,649,554 (GRCm39) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,610,283 (GRCm39) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,532,992 (GRCm39) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,620,778 (GRCm39) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,545,309 (GRCm39) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,506,084 (GRCm39) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,441,120 (GRCm39) nonsense probably null
R1710:Hmcn1 UTSW 1 150,551,735 (GRCm39) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,734,937 (GRCm39) missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150,474,781 (GRCm39) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,439,319 (GRCm39) missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150,624,834 (GRCm39) missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150,502,903 (GRCm39) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,474,036 (GRCm39) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,597,415 (GRCm39) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,532,944 (GRCm39) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,479,563 (GRCm39) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,596,446 (GRCm39) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,453,046 (GRCm39) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,533,202 (GRCm39) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,868,606 (GRCm39) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,480,633 (GRCm39) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,525,427 (GRCm39) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,553,127 (GRCm39) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,551,742 (GRCm39) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,614,364 (GRCm39) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,553,085 (GRCm39) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,453,074 (GRCm39) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,509,410 (GRCm39) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,591,566 (GRCm39) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,474,761 (GRCm39) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,500,349 (GRCm39) splice site probably benign
R2303:Hmcn1 UTSW 1 150,579,977 (GRCm39) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,528,429 (GRCm39) splice site probably benign
R2338:Hmcn1 UTSW 1 150,498,685 (GRCm39) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,441,135 (GRCm39) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,736,092 (GRCm39) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,474,783 (GRCm39) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,490,972 (GRCm39) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,562,618 (GRCm39) nonsense probably null
R2519:Hmcn1 UTSW 1 150,649,571 (GRCm39) nonsense probably null
R2520:Hmcn1 UTSW 1 150,619,398 (GRCm39) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,528,326 (GRCm39) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,506,403 (GRCm39) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2849:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,678,624 (GRCm39) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,624,786 (GRCm39) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,565,269 (GRCm39) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,620,776 (GRCm39) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,678,575 (GRCm39) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,462,169 (GRCm39) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,525,328 (GRCm39) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,462,716 (GRCm39) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,566,361 (GRCm39) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,449,320 (GRCm39) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,598,204 (GRCm39) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,598,120 (GRCm39) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,648,253 (GRCm39) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,534,259 (GRCm39) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,471,750 (GRCm39) splice site probably null
R4441:Hmcn1 UTSW 1 150,533,210 (GRCm39) missense probably null
R4493:Hmcn1 UTSW 1 150,577,650 (GRCm39) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,509,417 (GRCm39) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,439,531 (GRCm39) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,610,238 (GRCm39) missense probably benign
R4601:Hmcn1 UTSW 1 150,614,396 (GRCm39) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,471,645 (GRCm39) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,551,262 (GRCm39) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,500,301 (GRCm39) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,494,816 (GRCm39) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,648,322 (GRCm39) splice site probably null
R4724:Hmcn1 UTSW 1 150,570,584 (GRCm39) splice site probably null
R4737:Hmcn1 UTSW 1 150,565,346 (GRCm39) missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150,453,363 (GRCm39) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,468,836 (GRCm39) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,553,130 (GRCm39) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,598,286 (GRCm39) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,752,111 (GRCm39) intron probably benign
R4968:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,695,200 (GRCm39) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,556,439 (GRCm39) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,613,007 (GRCm39) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,486,420 (GRCm39) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,532,492 (GRCm39) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,522,452 (GRCm39) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,471,612 (GRCm39) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,555,265 (GRCm39) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,458,047 (GRCm39) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,631,123 (GRCm39) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,498,995 (GRCm39) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,577,723 (GRCm39) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,485,576 (GRCm39) splice site probably null
R5531:Hmcn1 UTSW 1 150,619,539 (GRCm39) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,631,042 (GRCm39) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,613,257 (GRCm39) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,453,290 (GRCm39) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,532,318 (GRCm39) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,534,313 (GRCm39) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,485,529 (GRCm39) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,566,351 (GRCm39) nonsense probably null
R5718:Hmcn1 UTSW 1 150,485,417 (GRCm39) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,570,600 (GRCm39) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,634,225 (GRCm39) splice site probably null
R5739:Hmcn1 UTSW 1 150,684,448 (GRCm39) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,449,305 (GRCm39) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,570,629 (GRCm39) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,550,098 (GRCm39) nonsense probably null
R5809:Hmcn1 UTSW 1 150,525,358 (GRCm39) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,613,275 (GRCm39) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,868,774 (GRCm39) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,506,078 (GRCm39) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,474,648 (GRCm39) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,453,047 (GRCm39) nonsense probably null
R5940:Hmcn1 UTSW 1 150,532,973 (GRCm39) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,439,568 (GRCm39) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,579,924 (GRCm39) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,678,646 (GRCm39) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,508,188 (GRCm39) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,539,660 (GRCm39) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,646,081 (GRCm39) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,631,045 (GRCm39) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,631,044 (GRCm39) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,506,978 (GRCm39) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,494,687 (GRCm39) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,598,175 (GRCm39) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,441,176 (GRCm39) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,522,535 (GRCm39) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6187:Hmcn1 UTSW 1 150,506,479 (GRCm39) missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150,614,432 (GRCm39) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,573,170 (GRCm39) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,573,227 (GRCm39) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,620,711 (GRCm39) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,868,670 (GRCm39) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,540,535 (GRCm39) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,553,053 (GRCm39) nonsense probably null
R6490:Hmcn1 UTSW 1 150,459,029 (GRCm39) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,573,317 (GRCm39) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6612:Hmcn1 UTSW 1 150,470,869 (GRCm39) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,599,008 (GRCm39) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,619,547 (GRCm39) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,634,057 (GRCm39) missense probably benign
R6687:Hmcn1 UTSW 1 150,620,784 (GRCm39) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,579,926 (GRCm39) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,610,269 (GRCm39) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,868,802 (GRCm39) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,475,404 (GRCm39) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,649,641 (GRCm39) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,479,853 (GRCm39) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,736,118 (GRCm39) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,479,997 (GRCm39) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,576,292 (GRCm39) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,452,961 (GRCm39) splice site probably null
R7144:Hmcn1 UTSW 1 150,539,624 (GRCm39) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,562,605 (GRCm39) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,624,744 (GRCm39) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,629,450 (GRCm39) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,525,331 (GRCm39) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,514,627 (GRCm39) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,598,394 (GRCm39) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,591,574 (GRCm39) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,458,088 (GRCm39) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,559,466 (GRCm39) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,608,880 (GRCm39) splice site probably null
R7316:Hmcn1 UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,479,565 (GRCm39) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,514,617 (GRCm39) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,559,496 (GRCm39) missense probably damaging 1.00
R7354:Hmcn1 UTSW 1 150,682,196 (GRCm39) nonsense probably null
R7360:Hmcn1 UTSW 1 150,494,597 (GRCm39) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,439,382 (GRCm39) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,522,421 (GRCm39) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,550,181 (GRCm39) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,596,510 (GRCm39) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,506,017 (GRCm39) nonsense probably null
R7454:Hmcn1 UTSW 1 150,439,355 (GRCm39) missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150,456,018 (GRCm39) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,552,985 (GRCm39) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,498,718 (GRCm39) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,532,324 (GRCm39) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,562,531 (GRCm39) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,480,625 (GRCm39) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,531,586 (GRCm39) missense probably benign
R7588:Hmcn1 UTSW 1 150,532,885 (GRCm39) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,441,080 (GRCm39) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,522,460 (GRCm39) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,543,631 (GRCm39) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,598,196 (GRCm39) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,632,343 (GRCm39) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,646,030 (GRCm39) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,682,172 (GRCm39) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,620,722 (GRCm39) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,468,940 (GRCm39) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,540,643 (GRCm39) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,525,835 (GRCm39) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,531,606 (GRCm39) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,540,629 (GRCm39) nonsense probably null
R8015:Hmcn1 UTSW 1 150,474,062 (GRCm39) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,525,743 (GRCm39) nonsense probably null
R8072:Hmcn1 UTSW 1 150,532,256 (GRCm39) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,624,841 (GRCm39) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,734,957 (GRCm39) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,629,411 (GRCm39) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,480,705 (GRCm39) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,522,409 (GRCm39) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,598,265 (GRCm39) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,453,228 (GRCm39) nonsense probably null
R8234:Hmcn1 UTSW 1 150,469,761 (GRCm39) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,695,117 (GRCm39) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,735,005 (GRCm39) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,614,515 (GRCm39) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,614,485 (GRCm39) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,634,142 (GRCm39) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,570,671 (GRCm39) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,479,551 (GRCm39) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,455,990 (GRCm39) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,449,302 (GRCm39) nonsense probably null
R8559:Hmcn1 UTSW 1 150,551,789 (GRCm39) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,631,008 (GRCm39) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,509,371 (GRCm39) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,556,413 (GRCm39) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,540,636 (GRCm39) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,591,469 (GRCm39) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,610,248 (GRCm39) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,531,570 (GRCm39) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,547,726 (GRCm39) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,514,659 (GRCm39) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,525,723 (GRCm39) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,649,530 (GRCm39) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,630,795 (GRCm39) intron probably benign
R9030:Hmcn1 UTSW 1 150,692,870 (GRCm39) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,565,320 (GRCm39) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,532,869 (GRCm39) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,573,331 (GRCm39) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,474,141 (GRCm39) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,506,092 (GRCm39) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,488,405 (GRCm39) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,500,337 (GRCm39) nonsense probably null
R9204:Hmcn1 UTSW 1 150,610,262 (GRCm39) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,594,844 (GRCm39) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,473,740 (GRCm39) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,506,046 (GRCm39) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,545,187 (GRCm39) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,506,053 (GRCm39) nonsense probably null
R9464:Hmcn1 UTSW 1 150,599,248 (GRCm39) missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150,506,471 (GRCm39) missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,610,281 (GRCm39) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,579,971 (GRCm39) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,470,990 (GRCm39) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,545,175 (GRCm39) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,498,660 (GRCm39) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,475,303 (GRCm39) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,555,346 (GRCm39) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,684,473 (GRCm39) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,506,054 (GRCm39) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,619,492 (GRCm39) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,613,356 (GRCm39) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,485,378 (GRCm39) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,674,566 (GRCm39) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,623,941 (GRCm39) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,632,339 (GRCm39) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,868,625 (GRCm39) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,598,380 (GRCm39) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,528,333 (GRCm39) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,684,391 (GRCm39) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,500,312 (GRCm39) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,510,897 (GRCm39) nonsense probably null
X0022:Hmcn1 UTSW 1 150,576,281 (GRCm39) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,736,127 (GRCm39) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,539,652 (GRCm39) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,524,688 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,539,668 (GRCm39) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,531,672 (GRCm39) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,462,196 (GRCm39) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- TTACACACAAGACAGTAGCACTTAG -3'
(R):5'- GGTCACTTGTTAGCAATGTTAGC -3'

Sequencing Primer
(F):5'- CAAGACAGTAGCACTTAGAAGTATC -3'
(R):5'- TTAGCAATGTTAGCAATGAAGATGG -3'
Posted On 2019-09-13