Incidental Mutation 'R7351:Olfr1246'
ID570554
Institutional Source Beutler Lab
Gene Symbol Olfr1246
Ensembl Gene ENSMUSG00000111715
Gene Nameolfactory receptor 1246
SynonymsGA_x6K02T2Q125-51034790-51033846, MOR231-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7351 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89586141-89593157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89590513 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 201 (G201S)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
Predicted Effect probably benign
Transcript: ENSMUST00000187990
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: G201S

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213221
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217192
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217254
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,412,510 G343V probably damaging Het
1700006E09Rik A G 11: 101,991,505 E163G probably benign Het
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adamts6 G A 13: 104,390,112 S516N possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Arhgef37 T A 18: 61,498,215 L566F possibly damaging Het
AU040320 A G 4: 126,816,444 N328D probably damaging Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Brk1 T C 6: 113,615,781 S42P probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Cenpo A T 12: 4,216,581 F176I probably damaging Het
Clec12b A G 6: 129,379,911 probably null Het
Ddx42 A G 11: 106,247,682 N769S probably benign Het
Drc7 A G 8: 95,058,507 D165G probably benign Het
Dync2h1 A T 9: 7,167,145 I486N probably damaging Het
Gmip A G 8: 69,817,384 D679G probably benign Het
Gml2 T C 15: 74,821,376 V76A possibly damaging Het
Gpr26 T C 7: 131,974,365 C253R probably damaging Het
H2-Q4 A G 17: 35,382,878 T239A possibly damaging Het
Hmcn1 T A 1: 150,667,889 Y2845F probably damaging Het
Ift172 A G 5: 31,275,896 Y550H probably damaging Het
Irgm2 G A 11: 58,219,605 V41M possibly damaging Het
Lrp2 C T 2: 69,448,142 G3956R probably damaging Het
Matn2 G A 15: 34,345,336 R163H probably damaging Het
Mxd1 A G 6: 86,651,466 S151P probably damaging Het
Olfr1022 G T 2: 85,864,071 probably benign Het
Olfr1330 T C 4: 118,893,836 V251A probably benign Het
Olfr147 C T 9: 38,403,443 L190F probably damaging Het
Plcg2 A G 8: 117,590,310 E642G possibly damaging Het
Pramel6 T A 2: 87,510,328 F335I probably benign Het
Psd G T 19: 46,322,430 S393R probably benign Het
Pwwp2a A G 11: 43,682,280 D63G probably benign Het
Rbm28 T C 6: 29,158,880 T139A probably benign Het
Ripk2 T G 4: 16,155,048 E157A probably damaging Het
Rnf145 G A 11: 44,548,796 V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 N114D probably benign Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Sec14l3 A G 11: 4,074,785 T245A probably benign Het
Serpina10 A T 12: 103,628,935 F8L probably benign Het
Slc16a8 T A 15: 79,253,641 D56V probably damaging Het
Spag9 A T 11: 94,092,976 E726D probably benign Het
Spg11 A G 2: 122,069,931 F1547L possibly damaging Het
Sspo T C 6: 48,464,921 I1955T possibly damaging Het
Stx18 T A 5: 38,039,411 V27E probably benign Het
Taf1c A G 8: 119,599,000 S708P probably damaging Het
Tas2r126 T C 6: 42,435,306 F258L probably benign Het
Tdpoz2 C T 3: 93,652,593 W24* probably null Het
Tmc8 T C 11: 117,783,828 L123P probably damaging Het
Trmo A T 4: 46,387,716 Y35N possibly damaging Het
Ttn C T 2: 76,767,686 V19628I possibly damaging Het
Ttn G A 2: 76,939,930 A2685V unknown Het
Usp15 A T 10: 123,132,999 M349K probably damaging Het
Vmn2r89 A G 14: 51,456,282 N363S probably benign Het
Vwa3a T A 7: 120,776,336 I423N probably damaging Het
Zfp592 T C 7: 81,041,691 V1206A probably benign Het
Zfp866 A T 8: 69,765,897 Y358N probably damaging Het
Other mutations in Olfr1246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr1246 APN 2 89590242 missense probably damaging 1.00
IGL02184:Olfr1246 APN 2 89590293 missense probably damaging 0.99
IGL03383:Olfr1246 APN 2 89590312 missense probably benign 0.24
PIT4283001:Olfr1246 UTSW 2 89590228 missense probably benign 0.01
R0453:Olfr1246 UTSW 2 89590751 nonsense probably null
R1614:Olfr1246 UTSW 2 89590696 missense possibly damaging 0.76
R2310:Olfr1246 UTSW 2 89590450 missense probably damaging 0.99
R2436:Olfr1246 UTSW 2 89590773 missense probably benign 0.42
R3683:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R3685:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R4037:Olfr1246 UTSW 2 89591035 missense probably benign 0.02
R5219:Olfr1246 UTSW 2 89590702 missense probably benign 0.03
R5350:Olfr1246 UTSW 2 89591088 missense possibly damaging 0.59
R5383:Olfr1246 UTSW 2 89591113 start codon destroyed probably null 0.91
R5639:Olfr1246 UTSW 2 89590725 missense probably damaging 1.00
R5927:Olfr1246 UTSW 2 89591100 missense possibly damaging 0.93
R6056:Olfr1246 UTSW 2 89591101 missense possibly damaging 0.93
R6177:Olfr1246 UTSW 2 89590317 missense possibly damaging 0.78
R7496:Olfr1246 UTSW 2 89590696 missense probably benign 0.05
R7583:Olfr1246 UTSW 2 89590751 nonsense probably null
R7973:Olfr1246 UTSW 2 89590987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCTGGCATACATGAAAATGC -3'
(R):5'- TAAACCACTGCACTATTTGACCATC -3'

Sequencing Primer
(F):5'- GCATACATGAAAATGCAGGGAAC -3'
(R):5'- CTGCACTATTTGACCATCATGAATCG -3'
Posted On2019-09-13