Incidental Mutation 'R7351:Or4a73'
ID 570554
Institutional Source Beutler Lab
Gene Symbol Or4a73
Ensembl Gene ENSMUSG00000111715
Gene Name olfactory receptor family 4 subfamily A member 73
Synonyms GA_x6K02T2Q125-51034790-51033846, Olfr1246, MOR231-9
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 89420413-89421490 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89420857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 201 (G201S)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
AlphaFold Q7TQZ6
Predicted Effect probably benign
Transcript: ENSMUST00000187990
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: G201S

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213221
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217192
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217254
AA Change: G201S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Or4a73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Or4a73 APN 2 89,420,586 (GRCm39) missense probably damaging 1.00
IGL02184:Or4a73 APN 2 89,420,637 (GRCm39) missense probably damaging 0.99
IGL03383:Or4a73 APN 2 89,420,656 (GRCm39) missense probably benign 0.24
PIT4283001:Or4a73 UTSW 2 89,420,572 (GRCm39) missense probably benign 0.01
R0453:Or4a73 UTSW 2 89,421,095 (GRCm39) nonsense probably null
R1614:Or4a73 UTSW 2 89,421,040 (GRCm39) missense possibly damaging 0.76
R2310:Or4a73 UTSW 2 89,420,794 (GRCm39) missense probably damaging 0.99
R2436:Or4a73 UTSW 2 89,421,117 (GRCm39) missense probably benign 0.42
R3683:Or4a73 UTSW 2 89,421,099 (GRCm39) missense probably damaging 0.96
R3685:Or4a73 UTSW 2 89,421,099 (GRCm39) missense probably damaging 0.96
R4037:Or4a73 UTSW 2 89,421,379 (GRCm39) missense probably benign 0.02
R5219:Or4a73 UTSW 2 89,421,046 (GRCm39) missense probably benign 0.03
R5350:Or4a73 UTSW 2 89,421,432 (GRCm39) missense possibly damaging 0.59
R5383:Or4a73 UTSW 2 89,421,457 (GRCm39) start codon destroyed probably null 0.91
R5639:Or4a73 UTSW 2 89,421,069 (GRCm39) missense probably damaging 1.00
R5927:Or4a73 UTSW 2 89,421,444 (GRCm39) missense possibly damaging 0.93
R6056:Or4a73 UTSW 2 89,421,445 (GRCm39) missense possibly damaging 0.93
R6177:Or4a73 UTSW 2 89,420,661 (GRCm39) missense possibly damaging 0.78
R7496:Or4a73 UTSW 2 89,421,040 (GRCm39) missense probably benign 0.05
R7583:Or4a73 UTSW 2 89,421,095 (GRCm39) nonsense probably null
R7973:Or4a73 UTSW 2 89,421,331 (GRCm39) missense probably damaging 1.00
R8770:Or4a73 UTSW 2 89,421,171 (GRCm39) missense probably benign 0.16
R8813:Or4a73 UTSW 2 89,420,730 (GRCm39) missense probably benign 0.18
R8821:Or4a73 UTSW 2 89,420,880 (GRCm39) missense probably damaging 0.98
R9037:Or4a73 UTSW 2 89,421,051 (GRCm39) missense probably benign 0.02
R9062:Or4a73 UTSW 2 89,420,923 (GRCm39) missense probably benign 0.01
R9262:Or4a73 UTSW 2 89,421,435 (GRCm39) missense probably damaging 0.99
R9554:Or4a73 UTSW 2 89,420,710 (GRCm39) missense probably damaging 0.99
R9623:Or4a73 UTSW 2 89,421,261 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTCTGGCATACATGAAAATGC -3'
(R):5'- TAAACCACTGCACTATTTGACCATC -3'

Sequencing Primer
(F):5'- GCATACATGAAAATGCAGGGAAC -3'
(R):5'- CTGCACTATTTGACCATCATGAATCG -3'
Posted On 2019-09-13