Incidental Mutation 'R7351:Ripk2'
ID 570558
Institutional Source Beutler Lab
Gene Symbol Ripk2
Ensembl Gene ENSMUSG00000041135
Gene Name receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms 2210420D18Rik, D4Bwg0615e, CARDIAK, RICK, CCK, CARD3, RIP2
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 16122733-16163647 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 16155048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 157 (E157A)
Ref Sequence ENSEMBL: ENSMUSP00000038833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]
AlphaFold P58801
Predicted Effect probably damaging
Transcript: ENSMUST00000037035
AA Change: E157A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135
AA Change: E157A

DomainStartEndE-ValueType
Pfam:Pkinase 18 289 2.1e-43 PFAM
Pfam:Pkinase_Tyr 18 290 1.1e-45 PFAM
CARD 434 522 2.34e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183871
AA Change: E157A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135
AA Change: E157A

DomainStartEndE-ValueType
Pfam:Pkinase 18 290 5.6e-46 PFAM
Pfam:Pkinase_Tyr 18 290 1.2e-44 PFAM
Meta Mutation Damage Score 0.3772 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Ripk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Ripk2 APN 4 16,139,198 (GRCm39) splice site probably benign
IGL01346:Ripk2 APN 4 16,132,775 (GRCm39) critical splice donor site probably null
IGL01631:Ripk2 APN 4 16,163,342 (GRCm39) missense possibly damaging 0.83
IGL02151:Ripk2 APN 4 16,139,240 (GRCm39) missense possibly damaging 0.83
IGL03093:Ripk2 APN 4 16,152,056 (GRCm39) missense probably damaging 1.00
R0066:Ripk2 UTSW 4 16,123,868 (GRCm39) nonsense probably null
R0066:Ripk2 UTSW 4 16,123,868 (GRCm39) nonsense probably null
R0189:Ripk2 UTSW 4 16,129,125 (GRCm39) splice site probably null
R1454:Ripk2 UTSW 4 16,163,239 (GRCm39) missense probably damaging 0.96
R1715:Ripk2 UTSW 4 16,155,192 (GRCm39) critical splice acceptor site probably null
R2153:Ripk2 UTSW 4 16,132,775 (GRCm39) critical splice donor site probably null
R2266:Ripk2 UTSW 4 16,152,011 (GRCm39) missense possibly damaging 0.91
R2394:Ripk2 UTSW 4 16,132,774 (GRCm39) splice site probably benign
R3693:Ripk2 UTSW 4 16,127,695 (GRCm39) missense probably benign
R4412:Ripk2 UTSW 4 16,124,511 (GRCm39) missense probably benign
R4463:Ripk2 UTSW 4 16,151,968 (GRCm39) missense possibly damaging 0.70
R4843:Ripk2 UTSW 4 16,155,073 (GRCm39) missense probably damaging 0.99
R5085:Ripk2 UTSW 4 16,127,663 (GRCm39) missense possibly damaging 0.78
R5453:Ripk2 UTSW 4 16,151,989 (GRCm39) missense probably damaging 1.00
R6197:Ripk2 UTSW 4 16,163,330 (GRCm39) missense probably damaging 1.00
R6576:Ripk2 UTSW 4 16,131,558 (GRCm39) splice site probably null
R6967:Ripk2 UTSW 4 16,158,275 (GRCm39) critical splice donor site probably null
R7479:Ripk2 UTSW 4 16,155,154 (GRCm39) missense probably benign 0.02
R7718:Ripk2 UTSW 4 16,151,968 (GRCm39) missense possibly damaging 0.70
R8188:Ripk2 UTSW 4 16,139,218 (GRCm39) missense probably damaging 1.00
R8242:Ripk2 UTSW 4 16,124,430 (GRCm39) missense probably benign 0.00
R8509:Ripk2 UTSW 4 16,124,436 (GRCm39) missense probably benign
R8700:Ripk2 UTSW 4 16,158,422 (GRCm39) missense possibly damaging 0.91
R8987:Ripk2 UTSW 4 16,123,699 (GRCm39) missense possibly damaging 0.72
R9084:Ripk2 UTSW 4 16,123,795 (GRCm39) missense probably damaging 1.00
R9202:Ripk2 UTSW 4 16,124,502 (GRCm39) missense probably benign
R9369:Ripk2 UTSW 4 16,127,651 (GRCm39) missense probably benign 0.01
R9469:Ripk2 UTSW 4 16,138,181 (GRCm39) missense possibly damaging 0.73
Z1176:Ripk2 UTSW 4 16,151,943 (GRCm39) missense probably damaging 1.00
Z1177:Ripk2 UTSW 4 16,163,331 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGAACTCAAGAAAGGGGC -3'
(R):5'- ATCTGTTTCCTGGTGGATTTCTTAAT -3'

Sequencing Primer
(F):5'- TGGTCCCACTGCAAAGTTG -3'
(R):5'- CCGCATCCTGCATGAAAT -3'
Posted On 2019-09-13