Incidental Mutation 'R7351:Samd9l'
ID 570566
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Name sterile alpha motif domain containing 9-like
Synonyms ESTM25
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 3372257-3399571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3374157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1035 (R1035C)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000120087
AA Change: R1035C

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: R1035C

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.1588 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3,376,779 (GRCm39) missense probably damaging 0.96
IGL00550:Samd9l APN 6 3,374,594 (GRCm39) missense probably benign 0.00
IGL01100:Samd9l APN 6 3,375,863 (GRCm39) missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3,376,259 (GRCm39) missense probably benign 0.42
IGL01553:Samd9l APN 6 3,375,566 (GRCm39) missense probably damaging 0.99
IGL01575:Samd9l APN 6 3,376,734 (GRCm39) missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3,375,120 (GRCm39) missense probably benign 0.02
IGL01915:Samd9l APN 6 3,373,864 (GRCm39) nonsense probably null
IGL02063:Samd9l APN 6 3,372,992 (GRCm39) missense probably damaging 1.00
IGL02066:Samd9l APN 6 3,376,575 (GRCm39) missense probably damaging 1.00
IGL02145:Samd9l APN 6 3,374,105 (GRCm39) missense probably benign 0.13
IGL02163:Samd9l APN 6 3,374,246 (GRCm39) missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3,376,197 (GRCm39) missense probably damaging 1.00
IGL02508:Samd9l APN 6 3,374,798 (GRCm39) missense probably damaging 1.00
IGL02591:Samd9l APN 6 3,375,760 (GRCm39) missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3,376,026 (GRCm39) missense probably damaging 1.00
IGL03058:Samd9l APN 6 3,374,980 (GRCm39) missense probably damaging 0.99
IGL03068:Samd9l APN 6 3,375,348 (GRCm39) nonsense probably null
IGL03160:Samd9l APN 6 3,374,894 (GRCm39) missense probably damaging 1.00
IGL03372:Samd9l APN 6 3,375,314 (GRCm39) missense probably damaging 1.00
IGL03385:Samd9l APN 6 3,376,208 (GRCm39) missense probably damaging 0.99
boston_lager UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
ipa UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
Paine UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
samad UTSW 6 3,374,032 (GRCm39) nonsense probably null
IGL03054:Samd9l UTSW 6 3,376,023 (GRCm39) missense probably damaging 1.00
R0111:Samd9l UTSW 6 3,374,946 (GRCm39) missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3,376,031 (GRCm39) missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3,377,264 (GRCm39) start gained probably benign
R0398:Samd9l UTSW 6 3,374,502 (GRCm39) missense probably damaging 1.00
R0744:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R1110:Samd9l UTSW 6 3,374,267 (GRCm39) missense probably benign 0.44
R1155:Samd9l UTSW 6 3,376,939 (GRCm39) missense probably benign 0.01
R1268:Samd9l UTSW 6 3,376,113 (GRCm39) missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3,373,947 (GRCm39) missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3,376,369 (GRCm39) missense probably benign 0.06
R1573:Samd9l UTSW 6 3,375,426 (GRCm39) missense probably damaging 0.99
R1590:Samd9l UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
R1611:Samd9l UTSW 6 3,373,771 (GRCm39) missense probably benign 0.00
R1754:Samd9l UTSW 6 3,373,126 (GRCm39) missense probably damaging 0.96
R1759:Samd9l UTSW 6 3,373,401 (GRCm39) missense probably damaging 1.00
R1795:Samd9l UTSW 6 3,375,264 (GRCm39) nonsense probably null
R1829:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3,376,269 (GRCm39) missense probably benign 0.01
R2154:Samd9l UTSW 6 3,372,945 (GRCm39) missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3,376,910 (GRCm39) missense probably benign 0.08
R3622:Samd9l UTSW 6 3,374,032 (GRCm39) nonsense probably null
R3903:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3904:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3945:Samd9l UTSW 6 3,377,029 (GRCm39) missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3,376,887 (GRCm39) missense probably benign 0.22
R4602:Samd9l UTSW 6 3,373,937 (GRCm39) frame shift probably null
R4602:Samd9l UTSW 6 3,373,935 (GRCm39) missense probably damaging 1.00
R4618:Samd9l UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
R4747:Samd9l UTSW 6 3,375,504 (GRCm39) nonsense probably null
R4762:Samd9l UTSW 6 3,375,623 (GRCm39) missense probably benign 0.01
R4814:Samd9l UTSW 6 3,372,863 (GRCm39) missense probably damaging 0.98
R4934:Samd9l UTSW 6 3,375,621 (GRCm39) nonsense probably null
R5026:Samd9l UTSW 6 3,375,284 (GRCm39) missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R5130:Samd9l UTSW 6 3,374,548 (GRCm39) missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3,376,156 (GRCm39) missense probably benign 0.02
R5328:Samd9l UTSW 6 3,376,739 (GRCm39) missense probably damaging 0.99
R5507:Samd9l UTSW 6 3,373,898 (GRCm39) missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3,373,291 (GRCm39) missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R5881:Samd9l UTSW 6 3,372,716 (GRCm39) missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3,376,460 (GRCm39) missense probably damaging 1.00
R6131:Samd9l UTSW 6 3,377,252 (GRCm39) missense probably benign 0.00
R6199:Samd9l UTSW 6 3,376,686 (GRCm39) missense probably benign 0.13
R6298:Samd9l UTSW 6 3,375,383 (GRCm39) missense probably damaging 1.00
R6331:Samd9l UTSW 6 3,376,361 (GRCm39) missense probably damaging 1.00
R6489:Samd9l UTSW 6 3,376,896 (GRCm39) missense probably benign
R6601:Samd9l UTSW 6 3,377,229 (GRCm39) missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3,377,247 (GRCm39) missense probably benign 0.22
R6803:Samd9l UTSW 6 3,375,446 (GRCm39) missense probably damaging 0.97
R6864:Samd9l UTSW 6 3,374,750 (GRCm39) missense probably benign 0.14
R6905:Samd9l UTSW 6 3,375,387 (GRCm39) missense probably damaging 0.99
R6919:Samd9l UTSW 6 3,376,313 (GRCm39) missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
R7073:Samd9l UTSW 6 3,375,856 (GRCm39) nonsense probably null
R7250:Samd9l UTSW 6 3,374,201 (GRCm39) missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3,372,600 (GRCm39) nonsense probably null
R7423:Samd9l UTSW 6 3,374,408 (GRCm39) missense probably damaging 1.00
R7610:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R7667:Samd9l UTSW 6 3,375,975 (GRCm39) missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3,373,646 (GRCm39) missense probably benign 0.16
R7680:Samd9l UTSW 6 3,376,469 (GRCm39) missense probably damaging 1.00
R7680:Samd9l UTSW 6 3,372,569 (GRCm39) missense probably damaging 1.00
R7814:Samd9l UTSW 6 3,374,793 (GRCm39) missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3,374,749 (GRCm39) missense probably benign 0.00
R8000:Samd9l UTSW 6 3,373,034 (GRCm39) missense probably damaging 1.00
R8098:Samd9l UTSW 6 3,375,549 (GRCm39) missense probably damaging 1.00
R8698:Samd9l UTSW 6 3,373,843 (GRCm39) missense probably benign 0.06
R8785:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R8795:Samd9l UTSW 6 3,374,221 (GRCm39) nonsense probably null
R8806:Samd9l UTSW 6 3,376,665 (GRCm39) missense probably damaging 0.99
R8832:Samd9l UTSW 6 3,374,990 (GRCm39) missense probably damaging 1.00
R8954:Samd9l UTSW 6 3,374,577 (GRCm39) missense probably damaging 0.98
R9023:Samd9l UTSW 6 3,373,791 (GRCm39) missense probably damaging 1.00
R9051:Samd9l UTSW 6 3,373,493 (GRCm39) missense probably benign 0.16
R9108:Samd9l UTSW 6 3,373,104 (GRCm39) missense possibly damaging 0.71
R9213:Samd9l UTSW 6 3,376,856 (GRCm39) missense probably benign 0.23
R9494:Samd9l UTSW 6 3,375,830 (GRCm39) missense possibly damaging 0.51
R9504:Samd9l UTSW 6 3,372,621 (GRCm39) missense probably benign 0.17
R9655:Samd9l UTSW 6 3,373,578 (GRCm39) missense probably benign 0.00
R9688:Samd9l UTSW 6 3,377,087 (GRCm39) missense probably damaging 1.00
R9696:Samd9l UTSW 6 3,375,078 (GRCm39) missense possibly damaging 0.76
R9721:Samd9l UTSW 6 3,375,854 (GRCm39) missense possibly damaging 0.69
X0026:Samd9l UTSW 6 3,375,560 (GRCm39) missense probably damaging 1.00
X0066:Samd9l UTSW 6 3,374,477 (GRCm39) missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3,376,770 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCAGATTTGCCCAGAC -3'
(R):5'- TCAGATTATGGGAGGTACACTGG -3'

Sequencing Primer
(F):5'- TTTGCCCAGACTAAAGCAGTG -3'
(R):5'- GGAGGTACACTGGTATACGTATC -3'
Posted On 2019-09-13