Incidental Mutation 'R7351:Gmip'
ID 570577
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene Name Gem-interacting protein
Synonyms 5031419I10Rik
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70261329-70274520 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70270034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 679 (D679G)
Ref Sequence ENSEMBL: ENSMUSP00000045676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036074] [ENSMUST00000123453]
AlphaFold Q6PGG2
Predicted Effect probably benign
Transcript: ENSMUST00000036074
AA Change: D679G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: D679G

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123453
AA Change: D679G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: D679G

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142659
SMART Domains Protein: ENSMUSP00000114525
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
Blast:RhoGAP 2 25 1e-7 BLAST
SCOP:d1f7ca_ 3 32 7e-4 SMART
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 70,269,661 (GRCm39) nonsense probably null
IGL02529:Gmip APN 8 70,269,439 (GRCm39) missense probably damaging 0.99
IGL03185:Gmip APN 8 70,262,433 (GRCm39) missense probably benign 0.02
IGL03328:Gmip APN 8 70,264,261 (GRCm39) missense possibly damaging 0.79
microdot UTSW 8 70,266,785 (GRCm39) missense probably damaging 1.00
minnox UTSW 8 70,270,452 (GRCm39) missense probably benign 0.02
puncta UTSW 8 70,268,736 (GRCm39) missense possibly damaging 0.50
R0110:Gmip UTSW 8 70,268,259 (GRCm39) unclassified probably benign
R0329:Gmip UTSW 8 70,263,468 (GRCm39) missense probably benign 0.06
R0330:Gmip UTSW 8 70,263,468 (GRCm39) missense probably benign 0.06
R0510:Gmip UTSW 8 70,268,259 (GRCm39) unclassified probably benign
R0638:Gmip UTSW 8 70,264,095 (GRCm39) splice site probably benign
R1692:Gmip UTSW 8 70,266,553 (GRCm39) missense probably benign
R1721:Gmip UTSW 8 70,263,882 (GRCm39) missense probably damaging 0.96
R1755:Gmip UTSW 8 70,266,774 (GRCm39) missense probably damaging 1.00
R1801:Gmip UTSW 8 70,267,127 (GRCm39) missense probably benign
R1894:Gmip UTSW 8 70,273,622 (GRCm39) missense probably damaging 1.00
R1926:Gmip UTSW 8 70,268,170 (GRCm39) missense probably benign 0.41
R2005:Gmip UTSW 8 70,266,693 (GRCm39) missense probably benign
R4280:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R4281:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R4282:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R4283:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R5221:Gmip UTSW 8 70,266,785 (GRCm39) missense probably damaging 1.00
R5512:Gmip UTSW 8 70,270,540 (GRCm39) missense probably benign 0.00
R5521:Gmip UTSW 8 70,270,049 (GRCm39) missense probably damaging 1.00
R5763:Gmip UTSW 8 70,270,501 (GRCm39) missense probably damaging 1.00
R6151:Gmip UTSW 8 70,269,735 (GRCm39) missense probably damaging 1.00
R6163:Gmip UTSW 8 70,270,022 (GRCm39) missense probably benign 0.28
R6228:Gmip UTSW 8 70,268,773 (GRCm39) missense probably damaging 1.00
R6775:Gmip UTSW 8 70,268,285 (GRCm39) missense possibly damaging 0.82
R6787:Gmip UTSW 8 70,266,436 (GRCm39) missense probably damaging 1.00
R6788:Gmip UTSW 8 70,263,826 (GRCm39) missense probably damaging 1.00
R6788:Gmip UTSW 8 70,263,824 (GRCm39) missense possibly damaging 0.87
R6852:Gmip UTSW 8 70,270,641 (GRCm39) nonsense probably null
R6934:Gmip UTSW 8 70,273,576 (GRCm39) missense probably benign
R7010:Gmip UTSW 8 70,264,050 (GRCm39) missense probably damaging 1.00
R7122:Gmip UTSW 8 70,270,452 (GRCm39) missense probably benign 0.02
R7254:Gmip UTSW 8 70,269,118 (GRCm39) splice site probably null
R7360:Gmip UTSW 8 70,263,892 (GRCm39) missense probably damaging 1.00
R7412:Gmip UTSW 8 70,273,149 (GRCm39) missense probably benign
R7577:Gmip UTSW 8 70,267,085 (GRCm39) missense probably benign 0.17
R7718:Gmip UTSW 8 70,270,383 (GRCm39) missense probably damaging 0.99
R8018:Gmip UTSW 8 70,268,143 (GRCm39) missense probably benign 0.41
R8080:Gmip UTSW 8 70,268,736 (GRCm39) missense possibly damaging 0.50
R8694:Gmip UTSW 8 70,270,485 (GRCm39) missense probably benign
R8750:Gmip UTSW 8 70,273,134 (GRCm39) missense probably benign 0.01
R8826:Gmip UTSW 8 70,268,748 (GRCm39) missense possibly damaging 0.72
R8917:Gmip UTSW 8 70,270,428 (GRCm39) missense probably damaging 1.00
R8953:Gmip UTSW 8 70,269,427 (GRCm39) missense probably damaging 1.00
R9035:Gmip UTSW 8 70,273,298 (GRCm39) missense probably damaging 0.96
R9350:Gmip UTSW 8 70,263,832 (GRCm39) missense probably damaging 1.00
R9463:Gmip UTSW 8 70,269,693 (GRCm39) missense possibly damaging 0.46
R9547:Gmip UTSW 8 70,273,381 (GRCm39) missense possibly damaging 0.95
R9771:Gmip UTSW 8 70,266,718 (GRCm39) missense probably benign 0.44
X0063:Gmip UTSW 8 70,262,466 (GRCm39) missense probably damaging 1.00
Z1176:Gmip UTSW 8 70,268,942 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCGATTTCTTCAGGAGGTAGG -3'
(R):5'- TGGGCATCCACAGTTCAGAG -3'

Sequencing Primer
(F):5'- TAGGTGGTTCCAGGCCAGAG -3'
(R):5'- GGCATCCACAGTTCAGAGTTCAG -3'
Posted On 2019-09-13