Incidental Mutation 'R7351:Taf1c'
ID 570580
Institutional Source Beutler Lab
Gene Symbol Taf1c
Ensembl Gene ENSMUSG00000031832
Gene Name TATA-box binding protein associated factor, RNA polymerase I, C
Synonyms mTAFI95
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120324713-120331945 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120325739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 708 (S708P)
Ref Sequence ENSEMBL: ENSMUSP00000090789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000093100] [ENSMUST00000147964]
AlphaFold Q6PDZ2
Predicted Effect probably damaging
Transcript: ENSMUST00000093099
AA Change: S708P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832
AA Change: S708P

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
SCOP:d1k32a3 253 389 2e-3 SMART
Blast:WD40 301 340 2e-15 BLAST
low complexity region 457 472 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093100
SMART Domains Protein: ENSMUSP00000090790
Gene: ENSMUSG00000031831

DomainStartEndE-ValueType
Pfam:LRR_9 115 298 5.7e-10 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147964
SMART Domains Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Taf1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Taf1c APN 8 120,328,067 (GRCm39) missense possibly damaging 0.80
IGL01098:Taf1c APN 8 120,329,580 (GRCm39) missense probably damaging 0.98
IGL01287:Taf1c APN 8 120,327,931 (GRCm39) missense probably benign 0.01
IGL02339:Taf1c APN 8 120,331,019 (GRCm39) missense probably damaging 1.00
IGL02642:Taf1c APN 8 120,325,796 (GRCm39) missense probably benign
IGL02954:Taf1c APN 8 120,327,225 (GRCm39) missense probably damaging 1.00
R0026:Taf1c UTSW 8 120,330,975 (GRCm39) splice site probably null
R0031:Taf1c UTSW 8 120,325,829 (GRCm39) missense probably benign 0.00
R0087:Taf1c UTSW 8 120,327,726 (GRCm39) missense probably damaging 1.00
R0197:Taf1c UTSW 8 120,326,722 (GRCm39) missense probably damaging 0.98
R0701:Taf1c UTSW 8 120,326,722 (GRCm39) missense probably damaging 0.98
R0883:Taf1c UTSW 8 120,326,722 (GRCm39) missense probably damaging 0.98
R2200:Taf1c UTSW 8 120,325,417 (GRCm39) missense probably benign
R3726:Taf1c UTSW 8 120,329,809 (GRCm39) missense probably damaging 1.00
R3765:Taf1c UTSW 8 120,327,224 (GRCm39) nonsense probably null
R3916:Taf1c UTSW 8 120,327,244 (GRCm39) missense probably damaging 1.00
R4368:Taf1c UTSW 8 120,326,055 (GRCm39) missense possibly damaging 0.60
R4470:Taf1c UTSW 8 120,326,361 (GRCm39) missense probably benign
R4501:Taf1c UTSW 8 120,326,168 (GRCm39) missense probably damaging 1.00
R4661:Taf1c UTSW 8 120,325,589 (GRCm39) missense probably damaging 0.99
R4741:Taf1c UTSW 8 120,330,134 (GRCm39) unclassified probably benign
R4938:Taf1c UTSW 8 120,325,537 (GRCm39) missense probably benign 0.26
R5481:Taf1c UTSW 8 120,325,979 (GRCm39) missense probably damaging 1.00
R6335:Taf1c UTSW 8 120,328,518 (GRCm39) missense probably damaging 1.00
R6517:Taf1c UTSW 8 120,330,986 (GRCm39) missense possibly damaging 0.59
R7083:Taf1c UTSW 8 120,327,407 (GRCm39) missense probably damaging 1.00
R8056:Taf1c UTSW 8 120,330,202 (GRCm39) missense probably benign 0.13
R8170:Taf1c UTSW 8 120,329,565 (GRCm39) splice site probably null
R8279:Taf1c UTSW 8 120,325,750 (GRCm39) missense probably benign
R8382:Taf1c UTSW 8 120,329,789 (GRCm39) missense probably damaging 1.00
R8492:Taf1c UTSW 8 120,325,456 (GRCm39) missense probably benign 0.13
R9375:Taf1c UTSW 8 120,325,393 (GRCm39) missense probably damaging 0.99
Z1177:Taf1c UTSW 8 120,325,566 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCACGCTTCACACCTTGG -3'
(R):5'- TTTTCTGGGCCACATGGAG -3'

Sequencing Primer
(F):5'- TCCTGTGTCAACTCCTGGGAG -3'
(R):5'- TGCCACAGAAGCTCCGAG -3'
Posted On 2019-09-13