Incidental Mutation 'R7351:Bicc1'
ID570584
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7351 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70947900 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 469 (T469K)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014473
AA Change: T469K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: T469K

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131445
AA Change: T387K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: T387K

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143791
AA Change: T469K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: T469K

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,412,510 G343V probably damaging Het
1700006E09Rik A G 11: 101,991,505 E163G probably benign Het
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adamts6 G A 13: 104,390,112 S516N possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Arhgef37 T A 18: 61,498,215 L566F possibly damaging Het
AU040320 A G 4: 126,816,444 N328D probably damaging Het
Brk1 T C 6: 113,615,781 S42P probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Cenpo A T 12: 4,216,581 F176I probably damaging Het
Clec12b A G 6: 129,379,911 probably null Het
Ddx42 A G 11: 106,247,682 N769S probably benign Het
Drc7 A G 8: 95,058,507 D165G probably benign Het
Dync2h1 A T 9: 7,167,145 I486N probably damaging Het
Gmip A G 8: 69,817,384 D679G probably benign Het
Gml2 T C 15: 74,821,376 V76A possibly damaging Het
Gpr26 T C 7: 131,974,365 C253R probably damaging Het
H2-Q4 A G 17: 35,382,878 T239A possibly damaging Het
Hmcn1 T A 1: 150,667,889 Y2845F probably damaging Het
Ift172 A G 5: 31,275,896 Y550H probably damaging Het
Irgm2 G A 11: 58,219,605 V41M possibly damaging Het
Lrp2 C T 2: 69,448,142 G3956R probably damaging Het
Matn2 G A 15: 34,345,336 R163H probably damaging Het
Mxd1 A G 6: 86,651,466 S151P probably damaging Het
Olfr1022 G T 2: 85,864,071 probably benign Het
Olfr1246 C T 2: 89,590,513 G201S probably benign Het
Olfr1330 T C 4: 118,893,836 V251A probably benign Het
Olfr147 C T 9: 38,403,443 L190F probably damaging Het
Plcg2 A G 8: 117,590,310 E642G possibly damaging Het
Pramel6 T A 2: 87,510,328 F335I probably benign Het
Psd G T 19: 46,322,430 S393R probably benign Het
Pwwp2a A G 11: 43,682,280 D63G probably benign Het
Rbm28 T C 6: 29,158,880 T139A probably benign Het
Ripk2 T G 4: 16,155,048 E157A probably damaging Het
Rnf145 G A 11: 44,548,796 V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 N114D probably benign Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Sec14l3 A G 11: 4,074,785 T245A probably benign Het
Serpina10 A T 12: 103,628,935 F8L probably benign Het
Slc16a8 T A 15: 79,253,641 D56V probably damaging Het
Spag9 A T 11: 94,092,976 E726D probably benign Het
Spg11 A G 2: 122,069,931 F1547L possibly damaging Het
Sspo T C 6: 48,464,921 I1955T possibly damaging Het
Stx18 T A 5: 38,039,411 V27E probably benign Het
Taf1c A G 8: 119,599,000 S708P probably damaging Het
Tas2r126 T C 6: 42,435,306 F258L probably benign Het
Tdpoz2 C T 3: 93,652,593 W24* probably null Het
Tmc8 T C 11: 117,783,828 L123P probably damaging Het
Trmo A T 4: 46,387,716 Y35N possibly damaging Het
Ttn C T 2: 76,767,686 V19628I possibly damaging Het
Ttn G A 2: 76,939,930 A2685V unknown Het
Usp15 A T 10: 123,132,999 M349K probably damaging Het
Vmn2r89 A G 14: 51,456,282 N363S probably benign Het
Vwa3a T A 7: 120,776,336 I423N probably damaging Het
Zfp592 T C 7: 81,041,691 V1206A probably benign Het
Zfp866 A T 8: 69,765,897 Y358N probably damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTATCTATGAATTCCCACTTC -3'
(R):5'- GGCAAGATTTCACGGGAATATCTG -3'

Sequencing Primer
(F):5'- CTTGATGCTTTAAGGGGCACTAACC -3'
(R):5'- TCACGGGAATATCTGAAATAACATC -3'
Posted On2019-09-13