Mutagenetix > Incidental Mutation

Incidental Mutation 'R7351:Bicc1'

570584

Institutional Source

Beutler Lab

Gene Symbol

Bicc1

Ensembl Gene

ENSMUSG00000014329

Gene Name

BicC family RNA binding protein 1

Synonyms

Bic-C, jcpk

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7351 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70922832-71159700 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 70947900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 469 (T469K)

Ref Sequence

ENSEMBL: ENSMUSP00000123201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]

AlphaFold

Q99MQ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014473
AA Change: T469K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: T469K

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	2.04e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131445
AA Change: T387K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: T387K

Domain	Start	End	E-Value	Type
SCOP:d1dtja_	1	46	1e-2	SMART
Blast:KH	1	47	1e-22	BLAST
KH	51	124	6.24e-18	SMART
KH	203	273	1.25e-8	SMART
low complexity region	302	320	N/A	INTRINSIC
low complexity region	365	385	N/A	INTRINSIC
low complexity region	398	417	N/A	INTRINSIC
low complexity region	618	636	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	712	733	N/A	INTRINSIC
SAM	790	856	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143791
AA Change: T469K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: T469K

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	4.26e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	A	3: 124,412,510	G343V	probably damaging	Het
1700006E09Rik	A	G	11: 101,991,505	E163G	probably benign	Het
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
Adamts6	G	A	13: 104,390,112	S516N	possibly damaging	Het
Ahi1	A	G	10: 20,965,933	D301G	probably damaging	Het
Arhgef37	T	A	18: 61,498,215	L566F	possibly damaging	Het
AU040320	A	G	4: 126,816,444	N328D	probably damaging	Het
Brk1	T	C	6: 113,615,781	S42P	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Cenpo	A	T	12: 4,216,581	F176I	probably damaging	Het
Clec12b	A	G	6: 129,379,911		probably null	Het
Ddx42	A	G	11: 106,247,682	N769S	probably benign	Het
Drc7	A	G	8: 95,058,507	D165G	probably benign	Het
Dync2h1	A	T	9: 7,167,145	I486N	probably damaging	Het
Gmip	A	G	8: 69,817,384	D679G	probably benign	Het
Gml2	T	C	15: 74,821,376	V76A	possibly damaging	Het
Gpr26	T	C	7: 131,974,365	C253R	probably damaging	Het
H2-Q4	A	G	17: 35,382,878	T239A	possibly damaging	Het
Hmcn1	T	A	1: 150,667,889	Y2845F	probably damaging	Het
Ift172	A	G	5: 31,275,896	Y550H	probably damaging	Het
Irgm2	G	A	11: 58,219,605	V41M	possibly damaging	Het
Lrp2	C	T	2: 69,448,142	G3956R	probably damaging	Het
Matn2	G	A	15: 34,345,336	R163H	probably damaging	Het
Mxd1	A	G	6: 86,651,466	S151P	probably damaging	Het
Olfr1022	G	T	2: 85,864,071		probably benign	Het
Olfr1246	C	T	2: 89,590,513	G201S	probably benign	Het
Olfr1330	T	C	4: 118,893,836	V251A	probably benign	Het
Olfr147	C	T	9: 38,403,443	L190F	probably damaging	Het
Plcg2	A	G	8: 117,590,310	E642G	possibly damaging	Het
Pramel6	T	A	2: 87,510,328	F335I	probably benign	Het
Psd	G	T	19: 46,322,430	S393R	probably benign	Het
Pwwp2a	A	G	11: 43,682,280	D63G	probably benign	Het
Rbm28	T	C	6: 29,158,880	T139A	probably benign	Het
Ripk2	T	G	4: 16,155,048	E157A	probably damaging	Het
Rnf145	G	A	11: 44,548,796	V140I	possibly damaging	Het
Rnf38	T	C	4: 44,149,102	N114D	probably benign	Het
Samd9l	G	A	6: 3,374,157	R1035C	probably benign	Het
Sec14l3	A	G	11: 4,074,785	T245A	probably benign	Het
Serpina10	A	T	12: 103,628,935	F8L	probably benign	Het
Slc16a8	T	A	15: 79,253,641	D56V	probably damaging	Het
Spag9	A	T	11: 94,092,976	E726D	probably benign	Het
Spg11	A	G	2: 122,069,931	F1547L	possibly damaging	Het
Sspo	T	C	6: 48,464,921	I1955T	possibly damaging	Het
Stx18	T	A	5: 38,039,411	V27E	probably benign	Het
Taf1c	A	G	8: 119,599,000	S708P	probably damaging	Het
Tas2r126	T	C	6: 42,435,306	F258L	probably benign	Het
Tdpoz2	C	T	3: 93,652,593	W24*	probably null	Het
Tmc8	T	C	11: 117,783,828	L123P	probably damaging	Het
Trmo	A	T	4: 46,387,716	Y35N	possibly damaging	Het
Ttn	C	T	2: 76,767,686	V19628I	possibly damaging	Het
Ttn	G	A	2: 76,939,930	A2685V	unknown	Het
Usp15	A	T	10: 123,132,999	M349K	probably damaging	Het
Vmn2r89	A	G	14: 51,456,282	N363S	probably benign	Het
Vwa3a	T	A	7: 120,776,336	I423N	probably damaging	Het
Zfp592	T	C	7: 81,041,691	V1206A	probably benign	Het
Zfp866	A	T	8: 69,765,897	Y358N	probably damaging	Het

Other mutations in Bicc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Bicc1	APN	10	70961157	missense	probably damaging	1.00
IGL01988:Bicc1	APN	10	70956176	missense	probably damaging	1.00
IGL02686:Bicc1	APN	10	70943360	splice site	probably benign
IGL02829:Bicc1	APN	10	70958880	missense	probably damaging	1.00
IGL03276:Bicc1	APN	10	70953438	missense	possibly damaging	0.76
IGL03354:Bicc1	APN	10	70946602	missense	probably benign	0.00
artemis	UTSW	10	71027954	missense	probably damaging	0.99
Pebbles	UTSW	10	70947900	missense	possibly damaging	0.95
PIT1430001:Bicc1	UTSW	10	70957681	missense	possibly damaging	0.94
R0095:Bicc1	UTSW	10	70961158	missense	probably damaging	1.00
R0142:Bicc1	UTSW	10	70925370	missense	probably damaging	1.00
R0184:Bicc1	UTSW	10	71079215	missense	probably benign
R0469:Bicc1	UTSW	10	71079215	missense	probably benign
R0485:Bicc1	UTSW	10	70925315	missense	probably damaging	0.96
R0520:Bicc1	UTSW	10	70957190	missense	probably damaging	0.96
R0884:Bicc1	UTSW	10	70958847	missense	probably damaging	1.00
R1678:Bicc1	UTSW	10	70943518	missense	probably damaging	1.00
R1892:Bicc1	UTSW	10	70958784	missense	probably damaging	1.00
R1943:Bicc1	UTSW	10	71159523	missense	probably damaging	1.00
R2220:Bicc1	UTSW	10	70950125	missense	probably damaging	1.00
R2240:Bicc1	UTSW	10	70946803	critical splice donor site	probably null
R2519:Bicc1	UTSW	10	70930644	missense	probably damaging	1.00
R4362:Bicc1	UTSW	10	70943374	frame shift	probably null
R4363:Bicc1	UTSW	10	70943374	frame shift	probably null
R4419:Bicc1	UTSW	10	70946974	missense	possibly damaging	0.73
R4697:Bicc1	UTSW	10	70953484	missense	possibly damaging	0.87
R4728:Bicc1	UTSW	10	70935831	critical splice donor site	probably null
R4765:Bicc1	UTSW	10	70940593	missense	probably damaging	1.00
R4838:Bicc1	UTSW	10	70945316	missense	possibly damaging	0.50
R5022:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5023:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5057:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5082:Bicc1	UTSW	10	70940522	missense	probably benign	0.05
R5160:Bicc1	UTSW	10	70932236	missense	probably damaging	1.00
R5294:Bicc1	UTSW	10	70947900	missense	possibly damaging	0.95
R5639:Bicc1	UTSW	10	70940520	missense	probably damaging	1.00
R5749:Bicc1	UTSW	10	70946969	missense	probably benign	0.00
R6045:Bicc1	UTSW	10	70957081	nonsense	probably null
R6128:Bicc1	UTSW	10	70940483	splice site	probably null
R6277:Bicc1	UTSW	10	71027901	missense	possibly damaging	0.74
R6389:Bicc1	UTSW	10	70958922	missense	probably damaging	1.00
R7021:Bicc1	UTSW	10	70961148	missense	probably damaging	0.99
R7101:Bicc1	UTSW	10	70930653	missense	probably damaging	1.00
R7352:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7353:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7366:Bicc1	UTSW	10	70943386	missense	probably benign	0.01
R7480:Bicc1	UTSW	10	70943476	missense	probably damaging	1.00
R7541:Bicc1	UTSW	10	70946604	missense	possibly damaging	0.82
R7544:Bicc1	UTSW	10	70956374	missense	possibly damaging	0.89
R7555:Bicc1	UTSW	10	70956291	missense	possibly damaging	0.75
R7663:Bicc1	UTSW	10	70946590	missense	probably benign
R7671:Bicc1	UTSW	10	70957167	missense	probably benign	0.01
R7747:Bicc1	UTSW	10	70946993	missense	probably benign
R8129:Bicc1	UTSW	10	71079203	missense	probably benign	0.01
R8270:Bicc1	UTSW	10	70932108	missense	probably damaging	0.99
R8525:Bicc1	UTSW	10	70943535	missense	possibly damaging	0.67
R8762:Bicc1	UTSW	10	70943386	missense	probably benign	0.03
R8849:Bicc1	UTSW	10	70946864	missense	probably benign	0.23
R9120:Bicc1	UTSW	10	70941032	missense	probably damaging	1.00
R9164:Bicc1	UTSW	10	70945264	missense	probably damaging	1.00
R9368:Bicc1	UTSW	10	70950087	missense	probably benign	0.13
R9452:Bicc1	UTSW	10	70957151	missense	probably damaging	0.99
R9497:Bicc1	UTSW	10	70940998	critical splice donor site	probably null
R9641:Bicc1	UTSW	10	71027942	missense	probably benign	0.01
R9672:Bicc1	UTSW	10	70958836	missense	probably damaging	1.00
RF013:Bicc1	UTSW	10	70935830	critical splice donor site	probably null
X0028:Bicc1	UTSW	10	70945336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAGTATCTATGAATTCCCACTTC -3'
(R):5'- GGCAAGATTTCACGGGAATATCTG -3'

Sequencing Primer
(F):5'- CTTGATGCTTTAAGGGGCACTAACC -3'
(R):5'- TCACGGGAATATCTGAAATAACATC -3'

Posted On

2019-09-13