Incidental Mutation 'R7351:Spag9'
ID 570590
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Name sperm associated antigen 9
Synonyms JLP, Mapk8ip4, 3110018C07Rik, JIP4, 4733401I23Rik, syd1, 4831406C20Rik
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.737) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 93886917-94016911 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93983802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 726 (E726D)
Ref Sequence ENSEMBL: ENSMUSP00000042271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079] [ENSMUST00000153076]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024979
AA Change: E588D

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: E588D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041956
AA Change: E726D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: E726D

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075695
AA Change: E587D

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: E587D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092777
AA Change: E588D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: E588D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103168
AA Change: E583D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: E583D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132079
AA Change: E376D

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859
AA Change: E376D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 360 394 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153076
AA Change: E307D

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: E307D

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859
AA Change: E575D

DomainStartEndE-ValueType
Pfam:JIP_LZII 240 310 1.1e-32 PFAM
coiled coil region 559 593 N/A INTRINSIC
low complexity region 723 739 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 93,988,692 (GRCm39) missense probably benign 0.02
IGL01776:Spag9 APN 11 94,007,553 (GRCm39) splice site probably benign
IGL02095:Spag9 APN 11 93,999,408 (GRCm39) missense probably damaging 1.00
IGL02307:Spag9 APN 11 93,992,986 (GRCm39) critical splice donor site probably null
IGL02417:Spag9 APN 11 94,007,567 (GRCm39) missense probably benign 0.27
IGL02480:Spag9 APN 11 93,999,413 (GRCm39) nonsense probably null
IGL02864:Spag9 APN 11 93,997,487 (GRCm39) missense probably damaging 1.00
IGL02976:Spag9 APN 11 93,974,779 (GRCm39) missense probably benign 0.30
IGL02979:Spag9 APN 11 93,988,190 (GRCm39) missense probably benign
IGL03349:Spag9 APN 11 93,984,335 (GRCm39) missense possibly damaging 0.51
dazzle UTSW 11 93,984,450 (GRCm39) nonsense probably null
R0128:Spag9 UTSW 11 93,984,365 (GRCm39) missense probably damaging 1.00
R0418:Spag9 UTSW 11 93,982,579 (GRCm39) splice site probably benign
R1463:Spag9 UTSW 11 94,007,663 (GRCm39) missense probably damaging 1.00
R1593:Spag9 UTSW 11 93,988,059 (GRCm39) missense probably damaging 1.00
R1605:Spag9 UTSW 11 93,939,365 (GRCm39) missense probably damaging 0.99
R1649:Spag9 UTSW 11 93,999,278 (GRCm39) splice site probably null
R1697:Spag9 UTSW 11 93,887,391 (GRCm39) missense probably benign 0.00
R1952:Spag9 UTSW 11 93,988,184 (GRCm39) missense possibly damaging 0.77
R2011:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2012:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2351:Spag9 UTSW 11 93,983,726 (GRCm39) missense probably damaging 1.00
R2367:Spag9 UTSW 11 94,007,583 (GRCm39) missense probably damaging 1.00
R3027:Spag9 UTSW 11 93,977,203 (GRCm39) missense probably null 1.00
R3766:Spag9 UTSW 11 93,951,109 (GRCm39) intron probably benign
R3777:Spag9 UTSW 11 93,989,852 (GRCm39) critical splice acceptor site probably null
R3937:Spag9 UTSW 11 93,935,305 (GRCm39) missense possibly damaging 0.92
R3937:Spag9 UTSW 11 93,935,243 (GRCm39) missense possibly damaging 0.94
R4417:Spag9 UTSW 11 93,951,172 (GRCm39) intron probably benign
R4445:Spag9 UTSW 11 93,988,079 (GRCm39) missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R4799:Spag9 UTSW 11 93,939,343 (GRCm39) missense probably damaging 0.96
R4799:Spag9 UTSW 11 93,939,342 (GRCm39) missense possibly damaging 0.87
R4816:Spag9 UTSW 11 93,939,425 (GRCm39) intron probably benign
R4843:Spag9 UTSW 11 93,988,644 (GRCm39) missense probably damaging 1.00
R5020:Spag9 UTSW 11 93,988,612 (GRCm39) missense probably benign 0.08
R5119:Spag9 UTSW 11 94,013,548 (GRCm39) missense probably damaging 1.00
R5298:Spag9 UTSW 11 93,990,961 (GRCm39) missense probably damaging 1.00
R5304:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5305:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5395:Spag9 UTSW 11 93,982,577 (GRCm39) splice site probably null
R5636:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5638:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5654:Spag9 UTSW 11 93,981,538 (GRCm39) missense probably damaging 1.00
R5779:Spag9 UTSW 11 94,005,079 (GRCm39) missense probably benign 0.20
R5814:Spag9 UTSW 11 93,973,654 (GRCm39) missense possibly damaging 0.94
R5912:Spag9 UTSW 11 93,935,251 (GRCm39) missense probably damaging 0.98
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6269:Spag9 UTSW 11 93,935,333 (GRCm39) missense probably benign 0.05
R6294:Spag9 UTSW 11 93,984,311 (GRCm39) critical splice acceptor site probably null
R6389:Spag9 UTSW 11 93,977,137 (GRCm39) missense probably damaging 1.00
R6420:Spag9 UTSW 11 93,977,128 (GRCm39) missense probably damaging 1.00
R6460:Spag9 UTSW 11 93,959,801 (GRCm39) missense probably damaging 1.00
R6482:Spag9 UTSW 11 93,984,328 (GRCm39) missense possibly damaging 0.94
R6860:Spag9 UTSW 11 93,972,196 (GRCm39) missense probably benign 0.25
R7086:Spag9 UTSW 11 93,988,690 (GRCm39) missense probably benign
R7179:Spag9 UTSW 11 93,980,258 (GRCm39) splice site probably null
R7225:Spag9 UTSW 11 93,988,184 (GRCm39) missense probably damaging 0.98
R7366:Spag9 UTSW 11 93,999,347 (GRCm39) missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R7401:Spag9 UTSW 11 93,988,515 (GRCm39) missense probably benign
R7506:Spag9 UTSW 11 93,999,290 (GRCm39) missense probably damaging 1.00
R7507:Spag9 UTSW 11 93,958,906 (GRCm39) missense probably benign 0.00
R7513:Spag9 UTSW 11 94,002,909 (GRCm39) missense probably damaging 1.00
R7655:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7664:Spag9 UTSW 11 93,992,986 (GRCm39) critical splice donor site probably null
R7665:Spag9 UTSW 11 93,904,480 (GRCm39) missense probably damaging 0.98
R7862:Spag9 UTSW 11 94,002,892 (GRCm39) missense possibly damaging 0.69
R8074:Spag9 UTSW 11 94,002,877 (GRCm39) missense probably damaging 1.00
R8085:Spag9 UTSW 11 93,989,870 (GRCm39) missense probably benign
R8469:Spag9 UTSW 11 93,982,627 (GRCm39) missense probably damaging 1.00
R8547:Spag9 UTSW 11 94,013,647 (GRCm39) missense possibly damaging 0.84
R8709:Spag9 UTSW 11 93,958,916 (GRCm39) missense probably benign 0.02
R8732:Spag9 UTSW 11 93,962,514 (GRCm39) critical splice donor site probably null
R8899:Spag9 UTSW 11 93,983,695 (GRCm39) missense probably damaging 1.00
R8983:Spag9 UTSW 11 93,958,815 (GRCm39) missense probably benign
R9043:Spag9 UTSW 11 93,951,085 (GRCm39) missense
R9050:Spag9 UTSW 11 93,935,294 (GRCm39) missense probably damaging 0.97
R9502:Spag9 UTSW 11 93,959,792 (GRCm39) missense probably damaging 1.00
R9575:Spag9 UTSW 11 93,962,409 (GRCm39) missense probably damaging 0.99
R9667:Spag9 UTSW 11 93,887,119 (GRCm39) missense possibly damaging 0.83
R9683:Spag9 UTSW 11 93,988,568 (GRCm39) missense probably damaging 1.00
R9774:Spag9 UTSW 11 94,005,062 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGACATAATAATTTTCTCCCTGCC -3'
(R):5'- TTGATCCCCACCATAGGCTG -3'

Sequencing Primer
(F):5'- CCTCTGCCTCTGAGAAGCTGTG -3'
(R):5'- CATAGGCTGCCTCAGACAAGTTTTG -3'
Posted On 2019-09-13