Incidental Mutation 'R7351:Adamts6'
ID 570596
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms b2b2029Clo, b2b2182Clo, b2b2187.1Clo, b2b1879.1Clo, A930019D11Rik, ADAM-TS6, b2b2228Clo
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.831) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 104424343-104633203 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104526620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 516 (S516N)
Ref Sequence ENSEMBL: ENSMUSP00000064570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224742] [ENSMUST00000224784]
AlphaFold D3Z1A5
Predicted Effect possibly damaging
Transcript: ENSMUST00000065766
AA Change: S516N

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: S516N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223562
Predicted Effect possibly damaging
Transcript: ENSMUST00000224208
AA Change: S516N

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect probably benign
Transcript: ENSMUST00000224784
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104,566,298 (GRCm39) missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104,433,726 (GRCm39) nonsense probably null
IGL01305:Adamts6 APN 13 104,526,590 (GRCm39) missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104,433,672 (GRCm39) missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104,526,700 (GRCm39) splice site probably benign
IGL01678:Adamts6 APN 13 104,450,196 (GRCm39) missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104,526,643 (GRCm39) missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104,450,168 (GRCm39) missense probably null 1.00
IGL02217:Adamts6 APN 13 104,598,873 (GRCm39) splice site probably benign
IGL02828:Adamts6 APN 13 104,433,978 (GRCm39) missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104,433,783 (GRCm39) missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104,581,464 (GRCm39) utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104,580,723 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104,450,842 (GRCm39) missense possibly damaging 0.77
De_vito UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
festinator UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
ANU22:Adamts6 UTSW 13 104,526,590 (GRCm39) missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104,433,999 (GRCm39) missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104,526,584 (GRCm39) critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104,563,438 (GRCm39) splice site probably benign
R0549:Adamts6 UTSW 13 104,433,763 (GRCm39) missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104,581,435 (GRCm39) missense probably benign 0.00
R0703:Adamts6 UTSW 13 104,489,355 (GRCm39) missense probably damaging 1.00
R0799:Adamts6 UTSW 13 104,450,779 (GRCm39) missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104,550,297 (GRCm39) missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104,449,389 (GRCm39) missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104,630,145 (GRCm39) missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104,581,383 (GRCm39) missense probably benign 0.26
R1619:Adamts6 UTSW 13 104,449,285 (GRCm39) missense probably benign 0.14
R1727:Adamts6 UTSW 13 104,565,472 (GRCm39) splice site probably benign
R1967:Adamts6 UTSW 13 104,563,459 (GRCm39) nonsense probably null
R2013:Adamts6 UTSW 13 104,450,812 (GRCm39) missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104,598,746 (GRCm39) missense probably benign 0.00
R2432:Adamts6 UTSW 13 104,563,485 (GRCm39) missense probably benign 0.01
R3118:Adamts6 UTSW 13 104,450,787 (GRCm39) missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104,449,412 (GRCm39) missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104,450,787 (GRCm39) missense possibly damaging 0.91
R4795:Adamts6 UTSW 13 104,580,636 (GRCm39) nonsense probably null
R4841:Adamts6 UTSW 13 104,449,295 (GRCm39) missense probably benign 0.00
R4976:Adamts6 UTSW 13 104,433,998 (GRCm39) missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104,443,751 (GRCm39) missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104,630,130 (GRCm39) missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104,489,323 (GRCm39) missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104,483,858 (GRCm39) missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104,433,933 (GRCm39) missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
R6243:Adamts6 UTSW 13 104,450,809 (GRCm39) missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104,598,790 (GRCm39) missense probably benign
R6743:Adamts6 UTSW 13 104,565,436 (GRCm39) missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104,450,160 (GRCm39) missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104,449,267 (GRCm39) missense probably benign
R7520:Adamts6 UTSW 13 104,433,694 (GRCm39) missense probably benign 0.01
R7866:Adamts6 UTSW 13 104,550,257 (GRCm39) nonsense probably null
R8274:Adamts6 UTSW 13 104,450,181 (GRCm39) missense probably benign 0.02
R8348:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8448:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8686:Adamts6 UTSW 13 104,450,207 (GRCm39) missense probably damaging 1.00
R8691:Adamts6 UTSW 13 104,450,839 (GRCm39) missense probably benign 0.00
R8962:Adamts6 UTSW 13 104,433,899 (GRCm39) missense probably damaging 0.99
R8978:Adamts6 UTSW 13 104,512,247 (GRCm39) missense probably damaging 1.00
R9075:Adamts6 UTSW 13 104,598,793 (GRCm39) missense probably benign
R9080:Adamts6 UTSW 13 104,449,427 (GRCm39) missense probably damaging 1.00
R9152:Adamts6 UTSW 13 104,613,275 (GRCm39) missense probably benign 0.06
R9213:Adamts6 UTSW 13 104,581,440 (GRCm39) missense probably damaging 1.00
R9536:Adamts6 UTSW 13 104,489,313 (GRCm39) missense probably benign 0.07
R9674:Adamts6 UTSW 13 104,563,448 (GRCm39) missense probably benign 0.17
X0065:Adamts6 UTSW 13 104,630,136 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTAAGTGGTCCTGCTACATG -3'
(R):5'- GCGCTGAAAATTGAGCCCAG -3'

Sequencing Primer
(F):5'- GTGGTCCTGCTACATGAAAAACTGAC -3'
(R):5'- GAAAATTGAGCCCAGACCTTTATAC -3'
Posted On 2019-09-13