Incidental Mutation 'R7351:Gml2'
ID 570599
Institutional Source Beutler Lab
Gene Symbol Gml2
Ensembl Gene ENSMUSG00000068600
Gene Name glycosylphosphatidylinositol anchored molecule like 2
Synonyms hematopoietic cell-specific transcript, HemT, Hemt1, 1700057K19Rik
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 74690920-74706720 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74693225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000094130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000096400] [ENSMUST00000164026] [ENSMUST00000185253] [ENSMUST00000188180]
AlphaFold G5E8L7
Predicted Effect possibly damaging
Transcript: ENSMUST00000096399
AA Change: V76A

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600
AA Change: V76A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.06e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096400
SMART Domains Protein: ENSMUSP00000094131
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164026
SMART Domains Protein: ENSMUSP00000128174
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185253
SMART Domains Protein: ENSMUSP00000140245
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UPAR_LY6 49 104 3.8e-3 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188180
AA Change: V76A

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600
AA Change: V76A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Gml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Gml2 APN 15 74,696,070 (GRCm39) nonsense probably null
R0031:Gml2 UTSW 15 74,696,125 (GRCm39) missense probably benign 0.12
R0608:Gml2 UTSW 15 74,693,235 (GRCm39) critical splice donor site probably null
R1087:Gml2 UTSW 15 74,695,946 (GRCm39) missense possibly damaging 0.73
R1130:Gml2 UTSW 15 74,693,195 (GRCm39) missense probably damaging 0.99
R1503:Gml2 UTSW 15 74,693,201 (GRCm39) nonsense probably null
R4408:Gml2 UTSW 15 74,696,188 (GRCm39) intron probably benign
R6802:Gml2 UTSW 15 74,696,095 (GRCm39) missense probably damaging 1.00
R7833:Gml2 UTSW 15 74,693,217 (GRCm39) nonsense probably null
R7910:Gml2 UTSW 15 74,692,379 (GRCm39) critical splice acceptor site probably null
R8513:Gml2 UTSW 15 74,696,004 (GRCm39) missense probably damaging 1.00
R8695:Gml2 UTSW 15 74,696,089 (GRCm39) missense probably benign 0.05
R9377:Gml2 UTSW 15 74,695,957 (GRCm39) missense probably benign 0.02
X0066:Gml2 UTSW 15 74,695,899 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTACACTGGAGAGCAGCC -3'
(R):5'- AGGCTCTTGGTGCCATTAG -3'

Sequencing Primer
(F):5'- CACTGGAGAGCAGCCGTGAG -3'
(R):5'- TTAGGCACACTACTCAAGCAGTGG -3'
Posted On 2019-09-13