Incidental Mutation 'R7351:Slc16a8'
ID 570600
Institutional Source Beutler Lab
Gene Symbol Slc16a8
Ensembl Gene ENSMUSG00000032988
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 8
Synonyms Mct3, proton-coupled monocarboxylate transporter 3
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 79135214-79138961 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79137841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 56 (D56V)
Ref Sequence ENSEMBL: ENSMUSP00000040522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018295] [ENSMUST00000039752] [ENSMUST00000053926] [ENSMUST00000163571] [ENSMUST00000165408] [ENSMUST00000166155]
AlphaFold O35308
Predicted Effect probably benign
Transcript: ENSMUST00000018295
SMART Domains Protein: ENSMUSP00000018295
Gene: ENSMUSG00000068206

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039752
AA Change: D56V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040522
Gene: ENSMUSG00000032988
AA Change: D56V

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:MFS_1 20 349 1.3e-28 PFAM
transmembrane domain 353 372 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053926
SMART Domains Protein: ENSMUSP00000061125
Gene: ENSMUSG00000116121

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 363 1.18e-103 SMART
GLECT 393 530 7.99e-3 SMART
Gal-bind_lectin 399 530 4.49e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163571
SMART Domains Protein: ENSMUSP00000128126
Gene: ENSMUSG00000068206

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165408
SMART Domains Protein: ENSMUSP00000127816
Gene: ENSMUSG00000018126

DomainStartEndE-ValueType
Pfam:IMD 16 226 1e-90 PFAM
low complexity region 232 244 N/A INTRINSIC
SH3 327 386 2.54e-9 SMART
low complexity region 389 409 N/A INTRINSIC
low complexity region 443 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166155
SMART Domains Protein: ENSMUSP00000129468
Gene: ENSMUSG00000068206

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A8 is a member of a family of proton-coupled monocarboxylate transporters that mediate lactate transport across cell membranes (Yoon et al., 1999 [PubMed 10493836]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced visual function, putatively due to changes in the ionic composition of the outer retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Psd G T 19: 46,310,869 (GRCm39) S393R probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Slc16a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Slc16a8 APN 15 79,135,432 (GRCm39) missense probably damaging 0.97
R0440:Slc16a8 UTSW 15 79,136,807 (GRCm39) missense probably damaging 1.00
R2239:Slc16a8 UTSW 15 79,137,147 (GRCm39) missense probably damaging 0.96
R3157:Slc16a8 UTSW 15 79,136,375 (GRCm39) missense probably damaging 1.00
R4967:Slc16a8 UTSW 15 79,137,084 (GRCm39) missense possibly damaging 0.85
R6200:Slc16a8 UTSW 15 79,137,137 (GRCm39) missense probably damaging 1.00
R6899:Slc16a8 UTSW 15 79,137,949 (GRCm39) missense possibly damaging 0.72
R7267:Slc16a8 UTSW 15 79,136,125 (GRCm39) frame shift probably null
R8785:Slc16a8 UTSW 15 79,136,513 (GRCm39) missense possibly damaging 0.85
R9576:Slc16a8 UTSW 15 79,136,182 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATCTGGGTCAATGTGCC -3'
(R):5'- AAAGGGTTCAGTGGGTGTCC -3'

Sequencing Primer
(F):5'- ACCCACTCGTTCCTAGGG -3'
(R):5'- ACCCAACCACACTGCCTTTTG -3'
Posted On 2019-09-13