Incidental Mutation 'R7351:Psd'
ID 570603
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Name pleckstrin and Sec7 domain containing
Synonyms Efa6, Psdl, Efa6a, 1110007H17Rik
MMRRC Submission 045437-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 46300526-46315595 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 46310869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 393 (S393R)
Ref Sequence ENSEMBL: ENSMUSP00000039728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000096029] [ENSMUST00000223903] [ENSMUST00000223917] [ENSMUST00000224447] [ENSMUST00000224556] [ENSMUST00000225323] [ENSMUST00000225781]
AlphaFold Q5DTT2
Predicted Effect probably benign
Transcript: ENSMUST00000041391
AA Change: S393R

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: S393R

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000096029
AA Change: S393R

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: S393R

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223903
Predicted Effect probably benign
Transcript: ENSMUST00000223917
Predicted Effect probably benign
Transcript: ENSMUST00000224447
Predicted Effect probably benign
Transcript: ENSMUST00000224556
Predicted Effect probably benign
Transcript: ENSMUST00000225323
AA Change: S393R

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000225781
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,206,159 (GRCm39) G343V probably damaging Het
Adamts6 G A 13: 104,526,620 (GRCm39) S516N possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Arhgef37 T A 18: 61,631,286 (GRCm39) L566F possibly damaging Het
AU040320 A G 4: 126,710,237 (GRCm39) N328D probably damaging Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Brk1 T C 6: 113,592,742 (GRCm39) S42P probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Cenpo A T 12: 4,266,581 (GRCm39) F176I probably damaging Het
Cfap97d1 A G 11: 101,882,331 (GRCm39) E163G probably benign Het
Clec12b A G 6: 129,356,874 (GRCm39) probably null Het
Ddx42 A G 11: 106,138,508 (GRCm39) N769S probably benign Het
Drc7 A G 8: 95,785,135 (GRCm39) D165G probably benign Het
Dync2h1 A T 9: 7,167,145 (GRCm39) I486N probably damaging Het
Gmip A G 8: 70,270,034 (GRCm39) D679G probably benign Het
Gml2 T C 15: 74,693,225 (GRCm39) V76A possibly damaging Het
Gpr26 T C 7: 131,576,094 (GRCm39) C253R probably damaging Het
H2-Q4 A G 17: 35,601,854 (GRCm39) T239A possibly damaging Het
Hmcn1 T A 1: 150,543,640 (GRCm39) Y2845F probably damaging Het
Ift172 A G 5: 31,433,240 (GRCm39) Y550H probably damaging Het
Irgm2 G A 11: 58,110,431 (GRCm39) V41M possibly damaging Het
Lrp2 C T 2: 69,278,486 (GRCm39) G3956R probably damaging Het
Matn2 G A 15: 34,345,482 (GRCm39) R163H probably damaging Het
Mxd1 A G 6: 86,628,448 (GRCm39) S151P probably damaging Het
Or10ak16 T C 4: 118,751,033 (GRCm39) V251A probably benign Het
Or4a73 C T 2: 89,420,857 (GRCm39) G201S probably benign Het
Or5m10b G T 2: 85,694,415 (GRCm39) probably benign Het
Or8b3 C T 9: 38,314,739 (GRCm39) L190F probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plcg2 A G 8: 118,317,049 (GRCm39) E642G possibly damaging Het
Pramel6 T A 2: 87,340,672 (GRCm39) F335I probably benign Het
Pwwp2a A G 11: 43,573,107 (GRCm39) D63G probably benign Het
Rbm28 T C 6: 29,158,879 (GRCm39) T139A probably benign Het
Ripk2 T G 4: 16,155,048 (GRCm39) E157A probably damaging Het
Rnf145 G A 11: 44,439,623 (GRCm39) V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 (GRCm39) N114D probably benign Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Sec14l3 A G 11: 4,024,785 (GRCm39) T245A probably benign Het
Serpina10 A T 12: 103,595,194 (GRCm39) F8L probably benign Het
Slc16a8 T A 15: 79,137,841 (GRCm39) D56V probably damaging Het
Spag9 A T 11: 93,983,802 (GRCm39) E726D probably benign Het
Spg11 A G 2: 121,900,412 (GRCm39) F1547L possibly damaging Het
Sspo T C 6: 48,441,855 (GRCm39) I1955T possibly damaging Het
Stx18 T A 5: 38,196,755 (GRCm39) V27E probably benign Het
Taf1c A G 8: 120,325,739 (GRCm39) S708P probably damaging Het
Tas2r126 T C 6: 42,412,240 (GRCm39) F258L probably benign Het
Tdpoz2 C T 3: 93,559,900 (GRCm39) W24* probably null Het
Tmc8 T C 11: 117,674,654 (GRCm39) L123P probably damaging Het
Trmo A T 4: 46,387,716 (GRCm39) Y35N possibly damaging Het
Ttn C T 2: 76,598,030 (GRCm39) V19628I possibly damaging Het
Ttn G A 2: 76,770,274 (GRCm39) A2685V unknown Het
Usp15 A T 10: 122,968,904 (GRCm39) M349K probably damaging Het
Vmn2r89 A G 14: 51,693,739 (GRCm39) N363S probably benign Het
Vwa3a T A 7: 120,375,559 (GRCm39) I423N probably damaging Het
Zfp592 T C 7: 80,691,439 (GRCm39) V1206A probably benign Het
Zfp866 A T 8: 70,218,547 (GRCm39) Y358N probably damaging Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46,303,186 (GRCm39) missense possibly damaging 0.77
IGL01307:Psd APN 19 46,303,097 (GRCm39) missense probably damaging 1.00
IGL02329:Psd APN 19 46,308,098 (GRCm39) missense possibly damaging 0.66
IGL02423:Psd APN 19 46,302,943 (GRCm39) missense possibly damaging 0.95
IGL02644:Psd APN 19 46,311,834 (GRCm39) missense probably damaging 1.00
IGL02724:Psd APN 19 46,307,984 (GRCm39) missense probably benign 0.04
IGL03117:Psd APN 19 46,311,561 (GRCm39) unclassified probably benign
ANU05:Psd UTSW 19 46,303,186 (GRCm39) missense possibly damaging 0.77
G1Funyon:Psd UTSW 19 46,309,541 (GRCm39) intron probably benign
P0035:Psd UTSW 19 46,309,400 (GRCm39) missense possibly damaging 0.56
R0054:Psd UTSW 19 46,311,781 (GRCm39) missense probably damaging 1.00
R0054:Psd UTSW 19 46,311,781 (GRCm39) missense probably damaging 1.00
R0403:Psd UTSW 19 46,309,411 (GRCm39) unclassified probably benign
R0499:Psd UTSW 19 46,310,600 (GRCm39) missense probably damaging 0.98
R0542:Psd UTSW 19 46,302,649 (GRCm39) missense probably damaging 1.00
R0543:Psd UTSW 19 46,307,956 (GRCm39) missense possibly damaging 0.62
R0894:Psd UTSW 19 46,301,880 (GRCm39) missense probably damaging 1.00
R1449:Psd UTSW 19 46,313,250 (GRCm39) missense probably damaging 0.99
R1586:Psd UTSW 19 46,303,237 (GRCm39) missense probably damaging 0.98
R2096:Psd UTSW 19 46,313,088 (GRCm39) splice site probably null
R2504:Psd UTSW 19 46,313,352 (GRCm39) missense possibly damaging 0.90
R2857:Psd UTSW 19 46,312,859 (GRCm39) missense probably benign 0.00
R2863:Psd UTSW 19 46,303,201 (GRCm39) missense probably damaging 0.97
R3897:Psd UTSW 19 46,313,024 (GRCm39) missense possibly damaging 0.93
R3967:Psd UTSW 19 46,312,845 (GRCm39) missense probably benign
R3970:Psd UTSW 19 46,312,845 (GRCm39) missense probably benign
R4435:Psd UTSW 19 46,302,933 (GRCm39) missense probably damaging 1.00
R4612:Psd UTSW 19 46,301,778 (GRCm39) missense probably benign 0.15
R4940:Psd UTSW 19 46,310,856 (GRCm39) missense probably damaging 1.00
R5055:Psd UTSW 19 46,310,907 (GRCm39) missense probably benign 0.00
R5485:Psd UTSW 19 46,304,528 (GRCm39) splice site probably null
R5768:Psd UTSW 19 46,301,178 (GRCm39) missense possibly damaging 0.84
R5775:Psd UTSW 19 46,303,211 (GRCm39) nonsense probably null
R6057:Psd UTSW 19 46,311,753 (GRCm39) missense possibly damaging 0.77
R6349:Psd UTSW 19 46,301,826 (GRCm39) splice site probably null
R6496:Psd UTSW 19 46,308,753 (GRCm39) missense probably damaging 1.00
R6614:Psd UTSW 19 46,301,851 (GRCm39) missense probably benign 0.11
R6820:Psd UTSW 19 46,309,283 (GRCm39) missense probably damaging 1.00
R6849:Psd UTSW 19 46,306,185 (GRCm39) missense probably damaging 0.97
R6860:Psd UTSW 19 46,310,858 (GRCm39) missense probably damaging 1.00
R7286:Psd UTSW 19 46,303,240 (GRCm39) missense probably damaging 0.98
R7326:Psd UTSW 19 46,312,893 (GRCm39) missense probably benign 0.01
R7593:Psd UTSW 19 46,301,352 (GRCm39) missense possibly damaging 0.47
R7614:Psd UTSW 19 46,301,877 (GRCm39) missense probably damaging 1.00
R7943:Psd UTSW 19 46,313,169 (GRCm39) missense possibly damaging 0.54
R8301:Psd UTSW 19 46,309,541 (GRCm39) intron probably benign
R8498:Psd UTSW 19 46,312,788 (GRCm39) missense probably damaging 1.00
R8712:Psd UTSW 19 46,301,775 (GRCm39) missense probably damaging 1.00
R8952:Psd UTSW 19 46,310,900 (GRCm39) missense probably damaging 1.00
R8980:Psd UTSW 19 46,310,657 (GRCm39) missense possibly damaging 0.95
R9168:Psd UTSW 19 46,309,233 (GRCm39) missense probably damaging 1.00
R9322:Psd UTSW 19 46,301,880 (GRCm39) missense probably damaging 1.00
R9512:Psd UTSW 19 46,306,154 (GRCm39) missense possibly damaging 0.79
R9569:Psd UTSW 19 46,308,717 (GRCm39) missense possibly damaging 0.94
R9638:Psd UTSW 19 46,301,841 (GRCm39) frame shift probably null
R9645:Psd UTSW 19 46,301,841 (GRCm39) frame shift probably null
R9721:Psd UTSW 19 46,311,628 (GRCm39) missense probably benign 0.00
Z1177:Psd UTSW 19 46,313,100 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCCAGAATCAGGTTCAAGAG -3'
(R):5'- CGGGACACTGAACTTCATGAG -3'

Sequencing Primer
(F):5'- CAGGTGCAGGTGGGTCAG -3'
(R):5'- CACTGAACTTCATGAGGTTTTGGATC -3'
Posted On 2019-09-13