Incidental Mutation 'R7352:Ush2a'
ID570610
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Nameusherin
SynonymsA930011D15Rik, LOC381317, A930037M10Rik, LOC269160, Usherin, MUSH2A
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R7352 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location188262023-188965041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 188466124 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1462 (A1462S)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
Predicted Effect probably benign
Transcript: ENSMUST00000060479
AA Change: A1462S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: A1462S

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 A T 5: 94,383,884 N209I probably damaging Het
Abca17 C T 17: 24,289,054 W1124* probably null Het
Acap3 G A 4: 155,905,711 V783I possibly damaging Het
Alkbh8 A G 9: 3,345,796 K172R probably damaging Het
Ankrd28 A G 14: 31,708,041 L860P probably damaging Het
Arap3 G A 18: 37,973,278 T1504I probably benign Het
Atad5 T C 11: 80,103,343 probably null Het
Atp8a2 A G 14: 59,791,204 V938A probably benign Het
AW551984 T C 9: 39,592,925 M582V probably benign Het
Axdnd1 C T 1: 156,382,477 V408I possibly damaging Het
Babam2 T A 5: 32,007,250 Y326* probably null Het
Baiap2l1 T C 5: 144,324,626 M20V probably benign Het
Bex6 A G 16: 32,186,216 probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Cad T A 5: 31,058,078 S78T probably damaging Het
Ccdc171 T A 4: 83,818,023 D1210E possibly damaging Het
Ccnd1 T C 7: 144,937,387 I161V possibly damaging Het
Cdc42bpb A T 12: 111,299,311 F1396I probably damaging Het
Cep170 A T 1: 176,769,857 D373E probably benign Het
Chrna4 A T 2: 181,037,474 I60N probably damaging Het
Cntn2 T C 1: 132,522,399 T586A probably benign Het
Csmd2 G T 4: 128,557,636 V3396F Het
Cyp3a44 T A 5: 145,803,688 L47F probably benign Het
D7Ertd443e A T 7: 134,349,394 H183Q probably benign Het
Ddx27 T C 2: 167,029,513 V510A probably benign Het
Ddx58 T A 4: 40,239,668 Q10L probably benign Het
Dgat1 G T 15: 76,502,824 C396* probably null Het
Dmpk A G 7: 19,086,072 S83G probably damaging Het
Dsc2 T G 18: 20,035,335 D689A probably benign Het
Eppk1 A T 15: 76,106,418 W2088R probably benign Het
Exph5 A C 9: 53,375,722 I1368L probably benign Het
Fadd T C 7: 144,580,659 K163R probably benign Het
Fam149a T A 8: 45,340,997 Q759L probably damaging Het
Foxo6 A T 4: 120,268,251 M449K probably benign Het
Gad1 T C 2: 70,594,750 F463L probably benign Het
Gad2 T A 2: 22,623,823 F91I probably benign Het
Gcc2 T C 10: 58,280,698 probably null Het
Gjc1 A C 11: 102,800,452 C242G probably damaging Het
Gkn1 T C 6: 87,348,118 E103G possibly damaging Het
Gm867 T C 10: 75,939,836 T39A probably benign Het
Gpr108 A G 17: 57,236,944 Y421H probably damaging Het
Gramd1b A C 9: 40,307,993 V508G probably damaging Het
Grm1 A T 10: 10,719,493 I797N probably damaging Het
Ice1 G A 13: 70,606,102 Q622* probably null Het
Kcnb2 T A 1: 15,710,611 V569E probably benign Het
Ksr2 T G 5: 117,689,641 I495S probably benign Het
Litaf A T 16: 10,963,353 M94K probably damaging Het
Lmod2 T C 6: 24,598,111 S77P possibly damaging Het
Lrp2 G T 2: 69,472,397 S2996Y probably benign Het
Ltf T C 9: 111,028,450 S436P probably benign Het
Map4k4 T A 1: 39,962,227 V58D unknown Het
Mapkapk3 C A 9: 107,257,070 D332Y possibly damaging Het
Mroh1 C A 15: 76,451,474 P1439Q probably benign Het
Ncor1 A G 11: 62,333,911 V841A probably damaging Het
Nrxn3 A G 12: 88,850,293 M248V probably benign Het
Olfr1000 T C 2: 85,608,784 N42S probably damaging Het
Olfr1208 T A 2: 88,896,718 N293I probably damaging Het
Olfr1238 T C 2: 89,406,462 M206V probably benign Het
Olfr1239 C A 2: 89,417,967 G149W probably damaging Het
Olfr1443 A G 19: 12,680,751 I214M possibly damaging Het
Olfr523 A T 7: 140,176,525 Y135F probably damaging Het
Olig2 A G 16: 91,226,689 D97G probably benign Het
Pcdha11 T A 18: 37,006,845 V509E probably damaging Het
Pglyrp3 G A 3: 92,014,640 W5* probably null Het
Phf14 A T 6: 11,961,638 N425Y probably damaging Het
Phf3 G T 1: 30,804,326 R1851S possibly damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Pnma2 A G 14: 66,916,421 Q98R possibly damaging Het
Ppp4r3a G A 12: 101,041,832 T782I probably damaging Het
Prickle2 T G 6: 92,410,890 E566D probably benign Het
Pvr A G 7: 19,910,616 I331T possibly damaging Het
Ranbp3l A T 15: 8,968,358 probably benign Het
Rapgef4 T A 2: 72,180,091 I331N probably damaging Het
Reg3g C T 6: 78,466,859 W122* probably null Het
Rlbp1 A T 7: 79,381,680 I100N probably damaging Het
Rnf213 T A 11: 119,443,579 Y3206N Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Rtl6 G T 15: 84,556,980 R72S possibly damaging Het
Rufy3 T A 5: 88,637,194 D408E possibly damaging Het
Scn3a T C 2: 65,525,701 I230V possibly damaging Het
Slc23a4 A T 6: 34,948,279 I507N possibly damaging Het
Slc4a8 A G 15: 100,790,984 T392A probably damaging Het
Spaca7 T A 8: 12,585,742 I86K probably benign Het
Syt10 G T 15: 89,814,456 D228E probably benign Het
Tbx3 T A 5: 119,677,560 N308K probably benign Het
Telo2 A G 17: 25,102,069 V724A probably damaging Het
Tfip11 T C 5: 112,333,268 V370A probably benign Het
Thbs3 A G 3: 89,225,280 E843G probably benign Het
Tmprss11g T C 5: 86,496,542 I148V not run Het
Trbv14 T A 6: 41,135,495 D75E possibly damaging Het
Trio A G 15: 27,732,876 V2973A probably damaging Het
Ttn T C 2: 76,794,484 D15250G probably damaging Het
Ubr2 G A 17: 46,930,426 T1734I probably benign Het
Ushbp1 T G 8: 71,388,881 T435P possibly damaging Het
Vps13c T C 9: 67,840,446 V7A possibly damaging Het
Wnk4 T C 11: 101,264,418 V385A probably damaging Het
Wnt2b C T 3: 104,947,177 V322I probably benign Het
Zbtb8a C T 4: 129,360,081 V207M probably benign Het
Zc3hav1l A G 6: 38,298,981 M87T probably benign Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188864678 missense probably benign 0.00
IGL00391:Ush2a APN 1 188916061 missense probably damaging 1.00
IGL00429:Ush2a APN 1 188400114 nonsense probably null
IGL00484:Ush2a APN 1 188782513 missense probably benign 0.00
IGL00519:Ush2a APN 1 188444668 missense probably benign 0.03
IGL00567:Ush2a APN 1 188964917 missense probably damaging 1.00
IGL00823:Ush2a APN 1 188911443 missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188357961 nonsense probably null
IGL00951:Ush2a APN 1 188263465 missense probably benign 0.33
IGL00956:Ush2a APN 1 188753522 missense probably damaging 0.99
IGL01096:Ush2a APN 1 188678377 missense probably damaging 1.00
IGL01108:Ush2a APN 1 188862825 missense probably benign 0.00
IGL01315:Ush2a APN 1 188633614 missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188814353 missense probably benign 0.00
IGL01324:Ush2a APN 1 188848992 missense probably benign 0.38
IGL01326:Ush2a APN 1 188263321 nonsense probably null
IGL01384:Ush2a APN 1 188553228 missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188911622 missense probably benign 0.00
IGL01518:Ush2a APN 1 188399785 missense probably benign 0.01
IGL01585:Ush2a APN 1 188430727 missense probably damaging 1.00
IGL01595:Ush2a APN 1 188654724 critical splice donor site probably null
IGL01657:Ush2a APN 1 188826461 missense probably benign 0.03
IGL01797:Ush2a APN 1 188263509 missense probably damaging 1.00
IGL01802:Ush2a APN 1 188436957 missense probably damaging 0.99
IGL01836:Ush2a APN 1 188759863 splice site probably benign
IGL01938:Ush2a APN 1 188797845 missense probably damaging 1.00
IGL01976:Ush2a APN 1 188911241 missense probably benign 0.04
IGL02023:Ush2a APN 1 188733514 missense probably benign 0.03
IGL02126:Ush2a APN 1 188263391 missense probably benign 0.01
IGL02133:Ush2a APN 1 188443343 missense probably damaging 1.00
IGL02147:Ush2a APN 1 188864703 missense probably benign
IGL02275:Ush2a APN 1 188263269 missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188633629 missense probably benign 0.00
IGL02353:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02360:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02367:Ush2a APN 1 188784746 missense probably benign
IGL02402:Ush2a APN 1 188267108 missense probably benign 0.02
IGL02410:Ush2a APN 1 188915997 missense probably damaging 1.00
IGL02490:Ush2a APN 1 188810364 missense probably damaging 1.00
IGL02500:Ush2a APN 1 188822696 missense probably damaging 1.00
IGL02511:Ush2a APN 1 188743687 critical splice donor site probably null
IGL02517:Ush2a APN 1 188915998 missense probably damaging 1.00
IGL02536:Ush2a APN 1 188957266 critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188728333 missense probably benign 0.00
IGL02610:Ush2a APN 1 188444466 missense probably damaging 0.98
IGL02677:Ush2a APN 1 188734685 missense probably damaging 1.00
IGL02691:Ush2a APN 1 188734752 missense probably damaging 1.00
IGL02740:Ush2a APN 1 188648388 missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188358717 splice site probably null
IGL02749:Ush2a APN 1 188946958 missense probably damaging 0.99
IGL02806:Ush2a APN 1 188810357 nonsense probably null
IGL02870:Ush2a APN 1 188678358 missense probably benign 0.42
IGL02894:Ush2a APN 1 188451846 missense probably damaging 1.00
IGL02904:Ush2a APN 1 188906506 missense probably benign 0.06
IGL03000:Ush2a APN 1 188549856 missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188436950 missense probably benign 0.01
IGL03036:Ush2a APN 1 188864621 missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188797838 missense probably damaging 1.00
IGL03230:Ush2a APN 1 188466193 missense probably benign 0.09
IGL03278:Ush2a APN 1 188849116 missense probably damaging 1.00
PIT4283001:Ush2a UTSW 1 188436867 missense probably benign 0.01
R0003:Ush2a UTSW 1 188578491 missense probably damaging 0.99
R0030:Ush2a UTSW 1 188822657 missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188356888 missense probably benign
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188948455 missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0208:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0230:Ush2a UTSW 1 188850104 missense probably damaging 1.00
R0269:Ush2a UTSW 1 188810176 missense probably benign 0.33
R0319:Ush2a UTSW 1 188948374 splice site probably benign
R0358:Ush2a UTSW 1 188537780 missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188451819 missense probably damaging 1.00
R0427:Ush2a UTSW 1 188400281 missense probably damaging 1.00
R0437:Ush2a UTSW 1 188911031 missense probably benign 0.00
R0462:Ush2a UTSW 1 188910939 missense probably benign
R0510:Ush2a UTSW 1 188734663 splice site probably benign
R0531:Ush2a UTSW 1 188443181 missense probably benign 0.18
R0541:Ush2a UTSW 1 188714466 splice site probably benign
R0549:Ush2a UTSW 1 188946953 missense probably damaging 0.99
R0562:Ush2a UTSW 1 188356847 missense probably damaging 1.00
R0636:Ush2a UTSW 1 188822738 missense probably benign
R0662:Ush2a UTSW 1 188351093 missense probably benign 0.26
R0685:Ush2a UTSW 1 188400278 missense probably damaging 1.00
R0718:Ush2a UTSW 1 188797830 missense probably damaging 1.00
R0725:Ush2a UTSW 1 188951525 missense probably damaging 1.00
R0735:Ush2a UTSW 1 188864693 missense probably benign 0.04
R0744:Ush2a UTSW 1 188814406 splice site probably benign
R0765:Ush2a UTSW 1 188948574 missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188542818 nonsense probably null
R1067:Ush2a UTSW 1 188550207 missense probably benign 0.35
R1072:Ush2a UTSW 1 188728717 missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188648348 missense probably benign 0.06
R1099:Ush2a UTSW 1 188864639 missense probably damaging 1.00
R1104:Ush2a UTSW 1 188916256 missense probably benign
R1106:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188753536 missense probably damaging 0.99
R1168:Ush2a UTSW 1 188678411 missense probably benign 0.01
R1199:Ush2a UTSW 1 188759795 missense probably benign 0.00
R1215:Ush2a UTSW 1 188957282 missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188357967 missense probably damaging 1.00
R1307:Ush2a UTSW 1 188451840 missense probably damaging 1.00
R1311:Ush2a UTSW 1 188947145 missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188523318 splice site probably benign
R1416:Ush2a UTSW 1 188436883 missense probably damaging 1.00
R1424:Ush2a UTSW 1 188542878 critical splice donor site probably null
R1459:Ush2a UTSW 1 188862851 missense probably benign 0.05
R1470:Ush2a UTSW 1 188400206 missense probably benign 0.00
R1470:Ush2a UTSW 1 188400206 missense probably benign 0.00
R1477:Ush2a UTSW 1 188849076 missense probably benign 0.05
R1484:Ush2a UTSW 1 188810337 nonsense probably null
R1490:Ush2a UTSW 1 188359841 missense probably benign 0.24
R1510:Ush2a UTSW 1 188648304 missense probably damaging 1.00
R1522:Ush2a UTSW 1 188797814 missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188759766 missense probably benign 0.17
R1618:Ush2a UTSW 1 188814224 missense probably benign 0.29
R1636:Ush2a UTSW 1 188466176 missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188415821 missense probably damaging 1.00
R1660:Ush2a UTSW 1 188916064 missense probably benign
R1676:Ush2a UTSW 1 188728585 missense probably damaging 1.00
R1704:Ush2a UTSW 1 188821796 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188874869 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188911541 missense probably benign 0.40
R1760:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188728203 missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188911185 missense probably benign 0.06
R1794:Ush2a UTSW 1 188862809 missense probably benign 0.00
R1796:Ush2a UTSW 1 188910827 missense probably benign 0.11
R1804:Ush2a UTSW 1 188633729 critical splice donor site probably null
R1835:Ush2a UTSW 1 188451818 missense probably benign 0.13
R1871:Ush2a UTSW 1 188826468 missense probably benign 0.02
R1876:Ush2a UTSW 1 188678289 missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188399980 missense probably benign 0.05
R1896:Ush2a UTSW 1 188550009 missense probably benign 0.00
R1907:Ush2a UTSW 1 188715064 missense probably benign 0.01
R1940:Ush2a UTSW 1 188951561 missense probably null 0.89
R1950:Ush2a UTSW 1 188755185 missense probably damaging 1.00
R1991:Ush2a UTSW 1 188578532 splice site probably benign
R2043:Ush2a UTSW 1 188916256 missense probably benign 0.00
R2046:Ush2a UTSW 1 188356927 missense probably benign 0.01
R2059:Ush2a UTSW 1 188381549 critical splice donor site probably null
R2239:Ush2a UTSW 1 188576214 missense probably benign
R2365:Ush2a UTSW 1 188378991 missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188947040 missense probably damaging 1.00
R2425:Ush2a UTSW 1 188537804 missense possibly damaging 0.82
R2519:Ush2a UTSW 1 188267107 missense probably benign
R3039:Ush2a UTSW 1 188911547 missense probably damaging 0.99
R3434:Ush2a UTSW 1 188733758 missense probably damaging 1.00
R3711:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3712:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3732:Ush2a UTSW 1 188944760 missense probably benign 0.16
R3746:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3747:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3883:Ush2a UTSW 1 188263382 missense probably benign
R3911:Ush2a UTSW 1 188399954 missense probably benign 0.05
R3934:Ush2a UTSW 1 188263511 critical splice donor site probably null
R3946:Ush2a UTSW 1 188728504 missense probably benign 0.01
R3974:Ush2a UTSW 1 188381501 missense probably benign 0.06
R4158:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4159:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4161:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4162:Ush2a UTSW 1 188743680 missense probably benign 0.00
R4255:Ush2a UTSW 1 188759843 nonsense probably null
R4280:Ush2a UTSW 1 188578461 missense probably benign 0.16
R4387:Ush2a UTSW 1 188443431 missense probably benign 0.00
R4416:Ush2a UTSW 1 188356874 missense probably damaging 0.97
R4494:Ush2a UTSW 1 188553276 missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188728596 missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188864625 missense probably damaging 1.00
R4584:Ush2a UTSW 1 188451798 missense probably benign 0.00
R4599:Ush2a UTSW 1 188911647 missense probably benign 0.01
R4605:Ush2a UTSW 1 188910801 missense probably damaging 1.00
R4632:Ush2a UTSW 1 188395874 missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188399941 missense probably benign 0.01
R4751:Ush2a UTSW 1 188850087 missense probably damaging 0.98
R4770:Ush2a UTSW 1 188549879 missense probably benign 0.25
R4771:Ush2a UTSW 1 188797769 missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188743545 missense probably damaging 1.00
R4821:Ush2a UTSW 1 188753651 missense probably benign 0.32
R4857:Ush2a UTSW 1 188537720 missense probably benign 0.01
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4898:Ush2a UTSW 1 188626608 missense probably benign 0.37
R4993:Ush2a UTSW 1 188910720 missense probably benign 0.03
R5035:Ush2a UTSW 1 188910808 missense probably damaging 1.00
R5061:Ush2a UTSW 1 188957274 missense probably benign 0.03
R5150:Ush2a UTSW 1 188451870 missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188874936 missense probably benign 0.21
R5212:Ush2a UTSW 1 188444705 critical splice donor site probably null
R5252:Ush2a UTSW 1 188821717 missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188947079 missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188356798 missense probably damaging 0.99
R5323:Ush2a UTSW 1 188821677 critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5331:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5332:Ush2a UTSW 1 188351079 missense probably damaging 1.00
R5371:Ush2a UTSW 1 188443070 missense probably benign 0.00
R5374:Ush2a UTSW 1 188755206 missense probably benign
R5377:Ush2a UTSW 1 188912123 missense probably benign 0.00
R5525:Ush2a UTSW 1 188753606 missense probably benign 0.01
R5558:Ush2a UTSW 1 188797827 missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188576217 missense probably damaging 1.00
R5595:Ush2a UTSW 1 188906498 missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188759823 missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188400257 missense probably benign 0.00
R5743:Ush2a UTSW 1 188436962 missense probably benign 0.01
R5779:Ush2a UTSW 1 188443510 critical splice donor site probably null
R5795:Ush2a UTSW 1 188443397 missense probably benign 0.34
R5897:Ush2a UTSW 1 188821738 missense probably damaging 1.00
R5918:Ush2a UTSW 1 188356814 missense probably benign 0.26
R6000:Ush2a UTSW 1 188267026 nonsense probably null
R6014:Ush2a UTSW 1 188850040 missense probably damaging 0.98
R6017:Ush2a UTSW 1 188957514 critical splice donor site probably null
R6020:Ush2a UTSW 1 188728096 splice site probably null
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188957324 missense probably benign 0.06
R6083:Ush2a UTSW 1 188267023 missense probably damaging 1.00
R6091:Ush2a UTSW 1 188399803 missense probably damaging 1.00
R6120:Ush2a UTSW 1 188358603 missense probably benign 0.04
R6135:Ush2a UTSW 1 188912106 missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188357963 missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188728270 missense probably benign 0.00
R6180:Ush2a UTSW 1 188399871 nonsense probably null
R6191:Ush2a UTSW 1 188263101 nonsense probably null
R6217:Ush2a UTSW 1 188743454 intron probably null
R6263:Ush2a UTSW 1 188358642 missense probably damaging 1.00
R6294:Ush2a UTSW 1 188536370 missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188356846 missense probably benign 0.01
R6321:Ush2a UTSW 1 188849046 nonsense probably null
R6347:Ush2a UTSW 1 188910887 missense probably benign
R6382:Ush2a UTSW 1 188814302 missense probably benign 0.01
R6408:Ush2a UTSW 1 188267032 nonsense probably null
R6418:Ush2a UTSW 1 188628566 missense probably damaging 1.00
R6500:Ush2a UTSW 1 188841527 missense probably benign 0.00
R6504:Ush2a UTSW 1 188911247 missense probably benign 0.00
R6534:Ush2a UTSW 1 188451802 nonsense probably null
R6594:Ush2a UTSW 1 188910798 missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188911397 missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188523331 missense probably damaging 0.99
R6658:Ush2a UTSW 1 188814359 missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188753684 missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188443219 missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188356834 missense probably benign
R6817:Ush2a UTSW 1 188862864 missense probably benign 0.03
R6834:Ush2a UTSW 1 188356792 missense probably damaging 1.00
R6851:Ush2a UTSW 1 188533205 missense probably benign 0.06
R6853:Ush2a UTSW 1 188911237 nonsense probably null
R6867:Ush2a UTSW 1 188910973 missense probably damaging 1.00
R6889:Ush2a UTSW 1 188797871 missense probably damaging 1.00
R6931:Ush2a UTSW 1 188728383 missense probably benign 0.01
R6953:Ush2a UTSW 1 188263145 missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188576244 missense probably damaging 1.00
R7109:Ush2a UTSW 1 188381484 missense probably benign 0.19
R7153:Ush2a UTSW 1 188728484 missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188537728 missense probably benign 0.00
R7182:Ush2a UTSW 1 188753543 missense probably benign 0.01
R7201:Ush2a UTSW 1 188874754 missense probably benign
R7223:Ush2a UTSW 1 188810217 missense probably benign 0.09
R7231:Ush2a UTSW 1 188759763 missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188911661 missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188443329 missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188553198 missense probably damaging 0.97
R7343:Ush2a UTSW 1 188415746 missense probably benign 0.00
R7384:Ush2a UTSW 1 188400163 missense probably damaging 0.99
R7391:Ush2a UTSW 1 188962008 small deletion probably benign
R7394:Ush2a UTSW 1 188911416 missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188633727 missense probably damaging 1.00
R7408:Ush2a UTSW 1 188733529 missense probably benign 0.00
R7453:Ush2a UTSW 1 188553111 missense probably damaging 1.00
R7496:Ush2a UTSW 1 188351087 missense possibly damaging 0.50
R7552:Ush2a UTSW 1 188267044 missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188957493 missense probably benign 0.31
R7575:Ush2a UTSW 1 188822688 missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188549913 missense probably damaging 1.00
R7584:Ush2a UTSW 1 188728109 critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188542849 missense probably benign 0.00
R7602:Ush2a UTSW 1 188648409 missense probably damaging 1.00
R7670:Ush2a UTSW 1 188784708 missense possibly damaging 0.78
R7743:Ush2a UTSW 1 188810179 missense probably benign 0.05
R7753:Ush2a UTSW 1 188443406 missense probably benign 0.28
R7767:Ush2a UTSW 1 188553260 missense probably benign 0.01
R7784:Ush2a UTSW 1 188444592 missense possibly damaging 0.55
RF017:Ush2a UTSW 1 188263469 missense probably damaging 1.00
U24488:Ush2a UTSW 1 188430766 missense probably damaging 0.99
X0011:Ush2a UTSW 1 188318969 missense probably benign 0.00
X0024:Ush2a UTSW 1 188400282 missense probably damaging 1.00
X0026:Ush2a UTSW 1 188319025 missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188549854 missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188911983 missense probably benign
Z1088:Ush2a UTSW 1 188947004 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAGGCAAGGAACCGTTGAAGTC -3'
(R):5'- CGTGAGCTGTTCTGGGAAAC -3'

Sequencing Primer
(F):5'- GGTACCTATAGTGGCTATAATCTCTC -3'
(R):5'- GGAAACCTGCAGTAACCGTGTC -3'
Posted On2019-09-13