Incidental Mutation 'R7352:Scn3a'
ID570612
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7352 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65525701 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 230 (I230V)
Ref Sequence ENSEMBL: ENSMUSP00000065023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066432
AA Change: I230V

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: I230V

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100069
AA Change: I230V

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: I230V

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126837
SMART Domains Protein: ENSMUSP00000115321
Gene: ENSMUSG00000057182

DomainStartEndE-ValueType
Pfam:Ion_trans 1 122 6.1e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 A T 5: 94,383,884 N209I probably damaging Het
Abca17 C T 17: 24,289,054 W1124* probably null Het
Acap3 G A 4: 155,905,711 V783I possibly damaging Het
Alkbh8 A G 9: 3,345,796 K172R probably damaging Het
Ankrd28 A G 14: 31,708,041 L860P probably damaging Het
Arap3 G A 18: 37,973,278 T1504I probably benign Het
Atad5 T C 11: 80,103,343 probably null Het
Atp8a2 A G 14: 59,791,204 V938A probably benign Het
AW551984 T C 9: 39,592,925 M582V probably benign Het
Axdnd1 C T 1: 156,382,477 V408I possibly damaging Het
Babam2 T A 5: 32,007,250 Y326* probably null Het
Baiap2l1 T C 5: 144,324,626 M20V probably benign Het
Bex6 A G 16: 32,186,216 probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Cad T A 5: 31,058,078 S78T probably damaging Het
Ccdc171 T A 4: 83,818,023 D1210E possibly damaging Het
Ccnd1 T C 7: 144,937,387 I161V possibly damaging Het
Cdc42bpb A T 12: 111,299,311 F1396I probably damaging Het
Cep170 A T 1: 176,769,857 D373E probably benign Het
Chrna4 A T 2: 181,037,474 I60N probably damaging Het
Cntn2 T C 1: 132,522,399 T586A probably benign Het
Csmd2 G T 4: 128,557,636 V3396F Het
Cyp3a44 T A 5: 145,803,688 L47F probably benign Het
D7Ertd443e A T 7: 134,349,394 H183Q probably benign Het
Ddx27 T C 2: 167,029,513 V510A probably benign Het
Ddx58 T A 4: 40,239,668 Q10L probably benign Het
Dgat1 G T 15: 76,502,824 C396* probably null Het
Dmpk A G 7: 19,086,072 S83G probably damaging Het
Dsc2 T G 18: 20,035,335 D689A probably benign Het
Eppk1 A T 15: 76,106,418 W2088R probably benign Het
Exph5 A C 9: 53,375,722 I1368L probably benign Het
Fadd T C 7: 144,580,659 K163R probably benign Het
Fam149a T A 8: 45,340,997 Q759L probably damaging Het
Foxo6 A T 4: 120,268,251 M449K probably benign Het
Gad1 T C 2: 70,594,750 F463L probably benign Het
Gad2 T A 2: 22,623,823 F91I probably benign Het
Gcc2 T C 10: 58,280,698 probably null Het
Gjc1 A C 11: 102,800,452 C242G probably damaging Het
Gkn1 T C 6: 87,348,118 E103G possibly damaging Het
Gm867 T C 10: 75,939,836 T39A probably benign Het
Gpr108 A G 17: 57,236,944 Y421H probably damaging Het
Gramd1b A C 9: 40,307,993 V508G probably damaging Het
Grm1 A T 10: 10,719,493 I797N probably damaging Het
Ice1 G A 13: 70,606,102 Q622* probably null Het
Kcnb2 T A 1: 15,710,611 V569E probably benign Het
Ksr2 T G 5: 117,689,641 I495S probably benign Het
Litaf A T 16: 10,963,353 M94K probably damaging Het
Lmod2 T C 6: 24,598,111 S77P possibly damaging Het
Lrp2 G T 2: 69,472,397 S2996Y probably benign Het
Ltf T C 9: 111,028,450 S436P probably benign Het
Map4k4 T A 1: 39,962,227 V58D unknown Het
Mapkapk3 C A 9: 107,257,070 D332Y possibly damaging Het
Mroh1 C A 15: 76,451,474 P1439Q probably benign Het
Ncor1 A G 11: 62,333,911 V841A probably damaging Het
Nrxn3 A G 12: 88,850,293 M248V probably benign Het
Olfr1000 T C 2: 85,608,784 N42S probably damaging Het
Olfr1208 T A 2: 88,896,718 N293I probably damaging Het
Olfr1238 T C 2: 89,406,462 M206V probably benign Het
Olfr1239 C A 2: 89,417,967 G149W probably damaging Het
Olfr1443 A G 19: 12,680,751 I214M possibly damaging Het
Olfr523 A T 7: 140,176,525 Y135F probably damaging Het
Olig2 A G 16: 91,226,689 D97G probably benign Het
Pcdha11 T A 18: 37,006,845 V509E probably damaging Het
Pglyrp3 G A 3: 92,014,640 W5* probably null Het
Phf14 A T 6: 11,961,638 N425Y probably damaging Het
Phf3 G T 1: 30,804,326 R1851S possibly damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Pnma2 A G 14: 66,916,421 Q98R possibly damaging Het
Ppp4r3a G A 12: 101,041,832 T782I probably damaging Het
Prickle2 T G 6: 92,410,890 E566D probably benign Het
Pvr A G 7: 19,910,616 I331T possibly damaging Het
Ranbp3l A T 15: 8,968,358 probably benign Het
Rapgef4 T A 2: 72,180,091 I331N probably damaging Het
Reg3g C T 6: 78,466,859 W122* probably null Het
Rlbp1 A T 7: 79,381,680 I100N probably damaging Het
Rnf213 T A 11: 119,443,579 Y3206N Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Rtl6 G T 15: 84,556,980 R72S possibly damaging Het
Rufy3 T A 5: 88,637,194 D408E possibly damaging Het
Slc23a4 A T 6: 34,948,279 I507N possibly damaging Het
Slc4a8 A G 15: 100,790,984 T392A probably damaging Het
Spaca7 T A 8: 12,585,742 I86K probably benign Het
Syt10 G T 15: 89,814,456 D228E probably benign Het
Tbx3 T A 5: 119,677,560 N308K probably benign Het
Telo2 A G 17: 25,102,069 V724A probably damaging Het
Tfip11 T C 5: 112,333,268 V370A probably benign Het
Thbs3 A G 3: 89,225,280 E843G probably benign Het
Tmprss11g T C 5: 86,496,542 I148V not run Het
Trbv14 T A 6: 41,135,495 D75E possibly damaging Het
Trio A G 15: 27,732,876 V2973A probably damaging Het
Ttn T C 2: 76,794,484 D15250G probably damaging Het
Ubr2 G A 17: 46,930,426 T1734I probably benign Het
Ush2a G T 1: 188,466,124 A1462S probably benign Het
Ushbp1 T G 8: 71,388,881 T435P possibly damaging Het
Vps13c T C 9: 67,840,446 V7A possibly damaging Het
Wnk4 T C 11: 101,264,418 V385A probably damaging Het
Wnt2b C T 3: 104,947,177 V322I probably benign Het
Zbtb8a C T 4: 129,360,081 V207M probably benign Het
Zc3hav1l A G 6: 38,298,981 M87T probably benign Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGGCTTTAATGAAGAAAGTTG -3'
(R):5'- GAGTCTTGCGAGCTCTGAAAAC -3'

Sequencing Primer
(F):5'- GAAATGATCAACGCTTTAAAGGAAC -3'
(R):5'- GCGAGCTCTGAAAACTATTTCTG -3'
Posted On2019-09-13