Incidental Mutation 'R7352:Ddx27'
ID570621
Institutional Source Beutler Lab
Gene Symbol Ddx27
Ensembl Gene ENSMUSG00000017999
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7352 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location167015193-167034947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167029513 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 510 (V510A)
Ref Sequence ENSEMBL: ENSMUSP00000018143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000150571] [ENSMUST00000176066]
Predicted Effect probably benign
Transcript: ENSMUST00000018143
AA Change: V510A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999
AA Change: V510A

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
DEXDc 203 404 2.24e-56 SMART
HELICc 443 524 1.71e-29 SMART
coiled coil region 577 613 N/A INTRINSIC
low complexity region 622 629 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150571
SMART Domains Protein: ENSMUSP00000135265
Gene: ENSMUSG00000017999

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
Pfam:DEAD 208 292 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176066
SMART Domains Protein: ENSMUSP00000135815
Gene: ENSMUSG00000017999

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
low complexity region 171 198 N/A INTRINSIC
Pfam:DEAD 236 309 1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein involved in the processing of 5.8S and 28S ribosomal RNAs. More specifically, the encoded protein localizes to the nucleolus, where it interacts with the PeBoW complex to ensure proper 3' end formation of 47S rRNA. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 A T 5: 94,383,884 N209I probably damaging Het
Abca17 C T 17: 24,289,054 W1124* probably null Het
Acap3 G A 4: 155,905,711 V783I possibly damaging Het
Alkbh8 A G 9: 3,345,796 K172R probably damaging Het
Ankrd28 A G 14: 31,708,041 L860P probably damaging Het
Arap3 G A 18: 37,973,278 T1504I probably benign Het
Atad5 T C 11: 80,103,343 probably null Het
Atp8a2 A G 14: 59,791,204 V938A probably benign Het
AW551984 T C 9: 39,592,925 M582V probably benign Het
Axdnd1 C T 1: 156,382,477 V408I possibly damaging Het
Babam2 T A 5: 32,007,250 Y326* probably null Het
Baiap2l1 T C 5: 144,324,626 M20V probably benign Het
Bex6 A G 16: 32,186,216 probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Cad T A 5: 31,058,078 S78T probably damaging Het
Ccdc171 T A 4: 83,818,023 D1210E possibly damaging Het
Ccnd1 T C 7: 144,937,387 I161V possibly damaging Het
Cdc42bpb A T 12: 111,299,311 F1396I probably damaging Het
Cep170 A T 1: 176,769,857 D373E probably benign Het
Chrna4 A T 2: 181,037,474 I60N probably damaging Het
Cntn2 T C 1: 132,522,399 T586A probably benign Het
Csmd2 G T 4: 128,557,636 V3396F Het
Cyp3a44 T A 5: 145,803,688 L47F probably benign Het
D7Ertd443e A T 7: 134,349,394 H183Q probably benign Het
Ddx58 T A 4: 40,239,668 Q10L probably benign Het
Dgat1 G T 15: 76,502,824 C396* probably null Het
Dmpk A G 7: 19,086,072 S83G probably damaging Het
Dsc2 T G 18: 20,035,335 D689A probably benign Het
Eppk1 A T 15: 76,106,418 W2088R probably benign Het
Exph5 A C 9: 53,375,722 I1368L probably benign Het
Fadd T C 7: 144,580,659 K163R probably benign Het
Fam149a T A 8: 45,340,997 Q759L probably damaging Het
Foxo6 A T 4: 120,268,251 M449K probably benign Het
Gad1 T C 2: 70,594,750 F463L probably benign Het
Gad2 T A 2: 22,623,823 F91I probably benign Het
Gcc2 T C 10: 58,280,698 probably null Het
Gjc1 A C 11: 102,800,452 C242G probably damaging Het
Gkn1 T C 6: 87,348,118 E103G possibly damaging Het
Gm867 T C 10: 75,939,836 T39A probably benign Het
Gpr108 A G 17: 57,236,944 Y421H probably damaging Het
Gramd1b A C 9: 40,307,993 V508G probably damaging Het
Grm1 A T 10: 10,719,493 I797N probably damaging Het
Ice1 G A 13: 70,606,102 Q622* probably null Het
Kcnb2 T A 1: 15,710,611 V569E probably benign Het
Ksr2 T G 5: 117,689,641 I495S probably benign Het
Litaf A T 16: 10,963,353 M94K probably damaging Het
Lmod2 T C 6: 24,598,111 S77P possibly damaging Het
Lrp2 G T 2: 69,472,397 S2996Y probably benign Het
Ltf T C 9: 111,028,450 S436P probably benign Het
Map4k4 T A 1: 39,962,227 V58D unknown Het
Mapkapk3 C A 9: 107,257,070 D332Y possibly damaging Het
Mroh1 C A 15: 76,451,474 P1439Q probably benign Het
Ncor1 A G 11: 62,333,911 V841A probably damaging Het
Nrxn3 A G 12: 88,850,293 M248V probably benign Het
Olfr1000 T C 2: 85,608,784 N42S probably damaging Het
Olfr1208 T A 2: 88,896,718 N293I probably damaging Het
Olfr1238 T C 2: 89,406,462 M206V probably benign Het
Olfr1239 C A 2: 89,417,967 G149W probably damaging Het
Olfr1443 A G 19: 12,680,751 I214M possibly damaging Het
Olfr523 A T 7: 140,176,525 Y135F probably damaging Het
Olig2 A G 16: 91,226,689 D97G probably benign Het
Pcdha11 T A 18: 37,006,845 V509E probably damaging Het
Pglyrp3 G A 3: 92,014,640 W5* probably null Het
Phf14 A T 6: 11,961,638 N425Y probably damaging Het
Phf3 G T 1: 30,804,326 R1851S possibly damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Pnma2 A G 14: 66,916,421 Q98R possibly damaging Het
Ppp4r3a G A 12: 101,041,832 T782I probably damaging Het
Prickle2 T G 6: 92,410,890 E566D probably benign Het
Pvr A G 7: 19,910,616 I331T possibly damaging Het
Ranbp3l A T 15: 8,968,358 probably benign Het
Rapgef4 T A 2: 72,180,091 I331N probably damaging Het
Reg3g C T 6: 78,466,859 W122* probably null Het
Rlbp1 A T 7: 79,381,680 I100N probably damaging Het
Rnf213 T A 11: 119,443,579 Y3206N Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Rtl6 G T 15: 84,556,980 R72S possibly damaging Het
Rufy3 T A 5: 88,637,194 D408E possibly damaging Het
Scn3a T C 2: 65,525,701 I230V possibly damaging Het
Slc23a4 A T 6: 34,948,279 I507N possibly damaging Het
Slc4a8 A G 15: 100,790,984 T392A probably damaging Het
Spaca7 T A 8: 12,585,742 I86K probably benign Het
Syt10 G T 15: 89,814,456 D228E probably benign Het
Tbx3 T A 5: 119,677,560 N308K probably benign Het
Telo2 A G 17: 25,102,069 V724A probably damaging Het
Tfip11 T C 5: 112,333,268 V370A probably benign Het
Thbs3 A G 3: 89,225,280 E843G probably benign Het
Tmprss11g T C 5: 86,496,542 I148V not run Het
Trbv14 T A 6: 41,135,495 D75E possibly damaging Het
Trio A G 15: 27,732,876 V2973A probably damaging Het
Ttn T C 2: 76,794,484 D15250G probably damaging Het
Ubr2 G A 17: 46,930,426 T1734I probably benign Het
Ush2a G T 1: 188,466,124 A1462S probably benign Het
Ushbp1 T G 8: 71,388,881 T435P possibly damaging Het
Vps13c T C 9: 67,840,446 V7A possibly damaging Het
Wnk4 T C 11: 101,264,418 V385A probably damaging Het
Wnt2b C T 3: 104,947,177 V322I probably benign Het
Zbtb8a C T 4: 129,360,081 V207M probably benign Het
Zc3hav1l A G 6: 38,298,981 M87T probably benign Het
Other mutations in Ddx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ddx27 APN 2 167019966 missense probably benign 0.00
IGL01610:Ddx27 APN 2 167022044 splice site probably benign
IGL01724:Ddx27 APN 2 167028389 missense probably damaging 1.00
IGL02035:Ddx27 APN 2 167029512 missense probably benign 0.00
IGL02141:Ddx27 APN 2 167020523 missense possibly damaging 0.67
IGL02402:Ddx27 APN 2 167015325 utr 5 prime probably benign
IGL02600:Ddx27 APN 2 167026204 missense probably damaging 1.00
IGL02882:Ddx27 APN 2 167027913 missense possibly damaging 0.86
IGL03177:Ddx27 APN 2 167027920 missense possibly damaging 0.76
R1938:Ddx27 UTSW 2 167034109 missense probably damaging 1.00
R2020:Ddx27 UTSW 2 167033771 missense probably damaging 1.00
R2038:Ddx27 UTSW 2 167033755 missense probably damaging 1.00
R2116:Ddx27 UTSW 2 167027764 missense probably benign 0.23
R3103:Ddx27 UTSW 2 167026246 missense probably damaging 1.00
R4524:Ddx27 UTSW 2 167027720 nonsense probably null
R4586:Ddx27 UTSW 2 167019984 missense probably benign 0.00
R4737:Ddx27 UTSW 2 167029299 missense probably benign 0.37
R5350:Ddx27 UTSW 2 167027860 unclassified probably benign
R5568:Ddx27 UTSW 2 167029519 missense possibly damaging 0.78
R5573:Ddx27 UTSW 2 167017886 missense possibly damaging 0.87
R5606:Ddx27 UTSW 2 167019966 missense probably benign 0.00
R6026:Ddx27 UTSW 2 167033640 missense probably benign 0.00
R6699:Ddx27 UTSW 2 167020503 missense possibly damaging 0.92
R6845:Ddx27 UTSW 2 167022096 missense probably damaging 1.00
R6941:Ddx27 UTSW 2 167015377 missense possibly damaging 0.93
R7765:Ddx27 UTSW 2 167027959 missense probably damaging 1.00
Z1177:Ddx27 UTSW 2 167033841 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGTCTTGACATTGAAGGAGTG -3'
(R):5'- TCTGACAAGCTGGACCCTAC -3'

Sequencing Primer
(F):5'- TCTTGACATTGAAGGAGTGAAAAC -3'
(R):5'- TGGTACACAGCTTCCTAGGG -3'
Posted On2019-09-13