Incidental Mutation 'R7352:Pglyrp3'
ID 570624
Institutional Source Beutler Lab
Gene Symbol Pglyrp3
Ensembl Gene ENSMUSG00000042244
Gene Name peptidoglycan recognition protein 3
Synonyms LOC242100
MMRRC Submission 045438-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 91921890-91938889 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 91921947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 5 (W5*)
Ref Sequence ENSEMBL: ENSMUSP00000035737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047660]
AlphaFold A1A547
Predicted Effect probably null
Transcript: ENSMUST00000047660
AA Change: W5*
SMART Domains Protein: ENSMUSP00000035737
Gene: ENSMUSG00000042244
AA Change: W5*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PGRP 28 169 2.64e-45 SMART
Ami_2 39 169 1.06e-2 SMART
PGRP 185 326 3.23e-72 SMART
Ami_2 195 332 1.75e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. These proteins are part of the innate immune system and recognize peptidoglycan, a ubiquitous component of bacterial cell walls. This antimicrobial protein binds to murein peptidoglycans of Gram-positive bacteria. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C T 17: 24,508,028 (GRCm39) W1124* probably null Het
Acap3 G A 4: 155,990,168 (GRCm39) V783I possibly damaging Het
Alkbh8 A G 9: 3,345,796 (GRCm39) K172R probably damaging Het
Ankrd28 A G 14: 31,429,998 (GRCm39) L860P probably damaging Het
Arap3 G A 18: 38,106,331 (GRCm39) T1504I probably benign Het
Atad5 T C 11: 79,994,169 (GRCm39) probably null Het
Atp8a2 A G 14: 60,028,653 (GRCm39) V938A probably benign Het
AW551984 T C 9: 39,504,221 (GRCm39) M582V probably benign Het
Axdnd1 C T 1: 156,210,047 (GRCm39) V408I possibly damaging Het
Babam2 T A 5: 32,164,594 (GRCm39) Y326* probably null Het
Baiap2l1 T C 5: 144,261,436 (GRCm39) M20V probably benign Het
Bex6 A G 16: 32,005,034 (GRCm39) probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Cad T A 5: 31,215,422 (GRCm39) S78T probably damaging Het
Ccdc171 T A 4: 83,736,260 (GRCm39) D1210E possibly damaging Het
Ccnd1 T C 7: 144,491,124 (GRCm39) I161V possibly damaging Het
Cdc42bpb A T 12: 111,265,745 (GRCm39) F1396I probably damaging Het
Cep170 A T 1: 176,597,423 (GRCm39) D373E probably benign Het
Chrna4 A T 2: 180,679,267 (GRCm39) I60N probably damaging Het
Cntn2 T C 1: 132,450,137 (GRCm39) T586A probably benign Het
Csmd2 G T 4: 128,451,429 (GRCm39) V3396F Het
Cyp3a44 T A 5: 145,740,498 (GRCm39) L47F probably benign Het
D7Ertd443e A T 7: 133,951,123 (GRCm39) H183Q probably benign Het
Ddx27 T C 2: 166,871,433 (GRCm39) V510A probably benign Het
Dgat1 G T 15: 76,387,024 (GRCm39) C396* probably null Het
Dmpk A G 7: 18,819,997 (GRCm39) S83G probably damaging Het
Dsc2 T G 18: 20,168,392 (GRCm39) D689A probably benign Het
Eppk1 A T 15: 75,990,618 (GRCm39) W2088R probably benign Het
Exph5 A C 9: 53,287,022 (GRCm39) I1368L probably benign Het
Fadd T C 7: 144,134,396 (GRCm39) K163R probably benign Het
Fam149a T A 8: 45,794,034 (GRCm39) Q759L probably damaging Het
Foxo6 A T 4: 120,125,448 (GRCm39) M449K probably benign Het
Gad1 T C 2: 70,425,094 (GRCm39) F463L probably benign Het
Gad2 T A 2: 22,513,835 (GRCm39) F91I probably benign Het
Gcc2 T C 10: 58,116,520 (GRCm39) probably null Het
Gjd3 A C 11: 102,691,278 (GRCm39) C242G probably damaging Het
Gkn1 T C 6: 87,325,100 (GRCm39) E103G possibly damaging Het
Gm867 T C 10: 75,775,670 (GRCm39) T39A probably benign Het
Gpr108 A G 17: 57,543,944 (GRCm39) Y421H probably damaging Het
Gramd1b A C 9: 40,219,289 (GRCm39) V508G probably damaging Het
Grm1 A T 10: 10,595,237 (GRCm39) I797N probably damaging Het
Ice1 G A 13: 70,754,221 (GRCm39) Q622* probably null Het
Kcnb2 T A 1: 15,780,835 (GRCm39) V569E probably benign Het
Ksr2 T G 5: 117,827,706 (GRCm39) I495S probably benign Het
Litaf A T 16: 10,781,217 (GRCm39) M94K probably damaging Het
Lmod2 T C 6: 24,598,110 (GRCm39) S77P possibly damaging Het
Lrp2 G T 2: 69,302,741 (GRCm39) S2996Y probably benign Het
Ltf T C 9: 110,857,518 (GRCm39) S436P probably benign Het
Map4k4 T A 1: 40,001,387 (GRCm39) V58D unknown Het
Mapkapk3 C A 9: 107,134,269 (GRCm39) D332Y possibly damaging Het
Mroh1 C A 15: 76,335,674 (GRCm39) P1439Q probably benign Het
Ncor1 A G 11: 62,224,737 (GRCm39) V841A probably damaging Het
Nrxn3 A G 12: 88,817,063 (GRCm39) M248V probably benign Het
Olig2 A G 16: 91,023,577 (GRCm39) D97G probably benign Het
Or4a2 C A 2: 89,248,311 (GRCm39) G149W probably damaging Het
Or4a39 T C 2: 89,236,806 (GRCm39) M206V probably benign Het
Or4p8 T A 2: 88,727,062 (GRCm39) N293I probably damaging Het
Or5b95 A G 19: 12,658,115 (GRCm39) I214M possibly damaging Het
Or5g23 T C 2: 85,439,128 (GRCm39) N42S probably damaging Het
Or6f2 A T 7: 139,756,438 (GRCm39) Y135F probably damaging Het
Pcdha11 T A 18: 37,139,898 (GRCm39) V509E probably damaging Het
Phf14 A T 6: 11,961,637 (GRCm39) N425Y probably damaging Het
Phf3 G T 1: 30,843,407 (GRCm39) R1851S possibly damaging Het
Pigs A G 11: 78,219,638 (GRCm39) T39A probably damaging Het
Plin4 A G 17: 56,411,427 (GRCm39) M868T probably benign Het
Pnma2 A G 14: 67,153,870 (GRCm39) Q98R possibly damaging Het
Ppp4r3a G A 12: 101,008,091 (GRCm39) T782I probably damaging Het
Pramel52-ps A T 5: 94,531,743 (GRCm39) N209I probably damaging Het
Prickle2 T G 6: 92,387,871 (GRCm39) E566D probably benign Het
Pvr A G 7: 19,644,541 (GRCm39) I331T possibly damaging Het
Ranbp3l A T 15: 8,997,842 (GRCm39) probably benign Het
Rapgef4 T A 2: 72,010,435 (GRCm39) I331N probably damaging Het
Reg3g C T 6: 78,443,842 (GRCm39) W122* probably null Het
Rigi T A 4: 40,239,668 (GRCm39) Q10L probably benign Het
Rlbp1 A T 7: 79,031,428 (GRCm39) I100N probably damaging Het
Rnf213 T A 11: 119,334,405 (GRCm39) Y3206N Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Rtl6 G T 15: 84,441,181 (GRCm39) R72S possibly damaging Het
Rufy3 T A 5: 88,785,053 (GRCm39) D408E possibly damaging Het
Scn3a T C 2: 65,356,045 (GRCm39) I230V possibly damaging Het
Slc23a4 A T 6: 34,925,214 (GRCm39) I507N possibly damaging Het
Slc4a8 A G 15: 100,688,865 (GRCm39) T392A probably damaging Het
Spaca7 T A 8: 12,635,742 (GRCm39) I86K probably benign Het
Syt10 G T 15: 89,698,659 (GRCm39) D228E probably benign Het
Tbx3 T A 5: 119,815,625 (GRCm39) N308K probably benign Het
Telo2 A G 17: 25,321,043 (GRCm39) V724A probably damaging Het
Tfip11 T C 5: 112,481,134 (GRCm39) V370A probably benign Het
Thbs3 A G 3: 89,132,587 (GRCm39) E843G probably benign Het
Tmprss11g T C 5: 86,644,401 (GRCm39) I148V not run Het
Trbv14 T A 6: 41,112,429 (GRCm39) D75E possibly damaging Het
Trio A G 15: 27,732,962 (GRCm39) V2973A probably damaging Het
Ttn T C 2: 76,624,828 (GRCm39) D15250G probably damaging Het
Ubr2 G A 17: 47,241,352 (GRCm39) T1734I probably benign Het
Ush2a G T 1: 188,198,321 (GRCm39) A1462S probably benign Het
Ushbp1 T G 8: 71,841,525 (GRCm39) T435P possibly damaging Het
Vps13c T C 9: 67,747,728 (GRCm39) V7A possibly damaging Het
Wnk4 T C 11: 101,155,244 (GRCm39) V385A probably damaging Het
Wnt2b C T 3: 104,854,493 (GRCm39) V322I probably benign Het
Zbtb8a C T 4: 129,253,874 (GRCm39) V207M probably benign Het
Zc3hav1l A G 6: 38,275,916 (GRCm39) M87T probably benign Het
Other mutations in Pglyrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Pglyrp3 APN 3 91,929,986 (GRCm39) missense probably damaging 0.96
IGL00769:Pglyrp3 APN 3 91,921,929 (GRCm39) utr 5 prime probably benign
IGL02491:Pglyrp3 APN 3 91,921,944 (GRCm39) missense possibly damaging 0.77
IGL03279:Pglyrp3 APN 3 91,933,834 (GRCm39) missense probably damaging 1.00
R0056:Pglyrp3 UTSW 3 91,933,111 (GRCm39) splice site probably benign
R1128:Pglyrp3 UTSW 3 91,935,479 (GRCm39) missense probably benign 0.22
R2097:Pglyrp3 UTSW 3 91,935,478 (GRCm39) missense possibly damaging 0.91
R2140:Pglyrp3 UTSW 3 91,933,874 (GRCm39) missense probably benign 0.00
R3697:Pglyrp3 UTSW 3 91,935,481 (GRCm39) missense probably damaging 1.00
R4369:Pglyrp3 UTSW 3 91,935,386 (GRCm39) missense probably damaging 1.00
R4430:Pglyrp3 UTSW 3 91,938,798 (GRCm39) missense probably damaging 1.00
R4775:Pglyrp3 UTSW 3 91,933,037 (GRCm39) missense possibly damaging 0.64
R6020:Pglyrp3 UTSW 3 91,938,841 (GRCm39) missense probably damaging 1.00
R7437:Pglyrp3 UTSW 3 91,937,985 (GRCm39) missense probably benign 0.00
R8150:Pglyrp3 UTSW 3 91,933,790 (GRCm39) missense probably benign 0.00
R8466:Pglyrp3 UTSW 3 91,921,941 (GRCm39) missense probably benign 0.16
R8695:Pglyrp3 UTSW 3 91,933,762 (GRCm39) missense probably null 1.00
R9413:Pglyrp3 UTSW 3 91,930,106 (GRCm39) missense probably damaging 1.00
R9479:Pglyrp3 UTSW 3 91,935,310 (GRCm39) missense probably benign 0.04
R9592:Pglyrp3 UTSW 3 91,938,859 (GRCm39) missense probably benign 0.22
R9722:Pglyrp3 UTSW 3 91,938,695 (GRCm39) missense possibly damaging 0.67
Z1176:Pglyrp3 UTSW 3 91,935,392 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGTTGGACCTGAGAAG -3'
(R):5'- AAATCACAACAGCTGGCAGG -3'

Sequencing Primer
(F):5'- TTGGACCTGAGAAGCCTGAGC -3'
(R):5'- GGCAGGACTAGAAATTGTCAATTCC -3'
Posted On 2019-09-13