Incidental Mutation 'R7352:Exph5'
ID570664
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Nameexophilin 5
SynonymsSlac2b, AC079869.22gm5, B130009M24Rik, slac2-b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7352 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location53301670-53377514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53375722 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1368 (I1368L)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
Predicted Effect probably benign
Transcript: ENSMUST00000051014
AA Change: I1368L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: I1368L

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 A T 5: 94,383,884 N209I probably damaging Het
Abca17 C T 17: 24,289,054 W1124* probably null Het
Acap3 G A 4: 155,905,711 V783I possibly damaging Het
Alkbh8 A G 9: 3,345,796 K172R probably damaging Het
Ankrd28 A G 14: 31,708,041 L860P probably damaging Het
Arap3 G A 18: 37,973,278 T1504I probably benign Het
Atad5 T C 11: 80,103,343 probably null Het
Atp8a2 A G 14: 59,791,204 V938A probably benign Het
AW551984 T C 9: 39,592,925 M582V probably benign Het
Axdnd1 C T 1: 156,382,477 V408I possibly damaging Het
Babam2 T A 5: 32,007,250 Y326* probably null Het
Baiap2l1 T C 5: 144,324,626 M20V probably benign Het
Bex6 A G 16: 32,186,216 probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Cad T A 5: 31,058,078 S78T probably damaging Het
Ccdc171 T A 4: 83,818,023 D1210E possibly damaging Het
Ccnd1 T C 7: 144,937,387 I161V possibly damaging Het
Cdc42bpb A T 12: 111,299,311 F1396I probably damaging Het
Cep170 A T 1: 176,769,857 D373E probably benign Het
Chrna4 A T 2: 181,037,474 I60N probably damaging Het
Cntn2 T C 1: 132,522,399 T586A probably benign Het
Csmd2 G T 4: 128,557,636 V3396F Het
Cyp3a44 T A 5: 145,803,688 L47F probably benign Het
D7Ertd443e A T 7: 134,349,394 H183Q probably benign Het
Ddx27 T C 2: 167,029,513 V510A probably benign Het
Ddx58 T A 4: 40,239,668 Q10L probably benign Het
Dgat1 G T 15: 76,502,824 C396* probably null Het
Dmpk A G 7: 19,086,072 S83G probably damaging Het
Dsc2 T G 18: 20,035,335 D689A probably benign Het
Eppk1 A T 15: 76,106,418 W2088R probably benign Het
Fadd T C 7: 144,580,659 K163R probably benign Het
Fam149a T A 8: 45,340,997 Q759L probably damaging Het
Foxo6 A T 4: 120,268,251 M449K probably benign Het
Gad1 T C 2: 70,594,750 F463L probably benign Het
Gad2 T A 2: 22,623,823 F91I probably benign Het
Gcc2 T C 10: 58,280,698 probably null Het
Gjc1 A C 11: 102,800,452 C242G probably damaging Het
Gkn1 T C 6: 87,348,118 E103G possibly damaging Het
Gm867 T C 10: 75,939,836 T39A probably benign Het
Gpr108 A G 17: 57,236,944 Y421H probably damaging Het
Gramd1b A C 9: 40,307,993 V508G probably damaging Het
Grm1 A T 10: 10,719,493 I797N probably damaging Het
Ice1 G A 13: 70,606,102 Q622* probably null Het
Kcnb2 T A 1: 15,710,611 V569E probably benign Het
Ksr2 T G 5: 117,689,641 I495S probably benign Het
Litaf A T 16: 10,963,353 M94K probably damaging Het
Lmod2 T C 6: 24,598,111 S77P possibly damaging Het
Lrp2 G T 2: 69,472,397 S2996Y probably benign Het
Ltf T C 9: 111,028,450 S436P probably benign Het
Map4k4 T A 1: 39,962,227 V58D unknown Het
Mapkapk3 C A 9: 107,257,070 D332Y possibly damaging Het
Mroh1 C A 15: 76,451,474 P1439Q probably benign Het
Ncor1 A G 11: 62,333,911 V841A probably damaging Het
Nrxn3 A G 12: 88,850,293 M248V probably benign Het
Olfr1000 T C 2: 85,608,784 N42S probably damaging Het
Olfr1208 T A 2: 88,896,718 N293I probably damaging Het
Olfr1238 T C 2: 89,406,462 M206V probably benign Het
Olfr1239 C A 2: 89,417,967 G149W probably damaging Het
Olfr1443 A G 19: 12,680,751 I214M possibly damaging Het
Olfr523 A T 7: 140,176,525 Y135F probably damaging Het
Olig2 A G 16: 91,226,689 D97G probably benign Het
Pcdha11 T A 18: 37,006,845 V509E probably damaging Het
Pglyrp3 G A 3: 92,014,640 W5* probably null Het
Phf14 A T 6: 11,961,638 N425Y probably damaging Het
Phf3 G T 1: 30,804,326 R1851S possibly damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Pnma2 A G 14: 66,916,421 Q98R possibly damaging Het
Ppp4r3a G A 12: 101,041,832 T782I probably damaging Het
Prickle2 T G 6: 92,410,890 E566D probably benign Het
Pvr A G 7: 19,910,616 I331T possibly damaging Het
Ranbp3l A T 15: 8,968,358 probably benign Het
Rapgef4 T A 2: 72,180,091 I331N probably damaging Het
Reg3g C T 6: 78,466,859 W122* probably null Het
Rlbp1 A T 7: 79,381,680 I100N probably damaging Het
Rnf213 T A 11: 119,443,579 Y3206N Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Rtl6 G T 15: 84,556,980 R72S possibly damaging Het
Rufy3 T A 5: 88,637,194 D408E possibly damaging Het
Scn3a T C 2: 65,525,701 I230V possibly damaging Het
Slc23a4 A T 6: 34,948,279 I507N possibly damaging Het
Slc4a8 A G 15: 100,790,984 T392A probably damaging Het
Spaca7 T A 8: 12,585,742 I86K probably benign Het
Syt10 G T 15: 89,814,456 D228E probably benign Het
Tbx3 T A 5: 119,677,560 N308K probably benign Het
Telo2 A G 17: 25,102,069 V724A probably damaging Het
Tfip11 T C 5: 112,333,268 V370A probably benign Het
Thbs3 A G 3: 89,225,280 E843G probably benign Het
Tmprss11g T C 5: 86,496,542 I148V not run Het
Trbv14 T A 6: 41,135,495 D75E possibly damaging Het
Trio A G 15: 27,732,876 V2973A probably damaging Het
Ttn T C 2: 76,794,484 D15250G probably damaging Het
Ubr2 G A 17: 46,930,426 T1734I probably benign Het
Ush2a G T 1: 188,466,124 A1462S probably benign Het
Ushbp1 T G 8: 71,388,881 T435P possibly damaging Het
Vps13c T C 9: 67,840,446 V7A possibly damaging Het
Wnk4 T C 11: 101,264,418 V385A probably damaging Het
Wnt2b C T 3: 104,947,177 V322I probably benign Het
Zbtb8a C T 4: 129,360,081 V207M probably benign Het
Zc3hav1l A G 6: 38,298,981 M87T probably benign Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53376706 nonsense probably null
IGL01387:Exph5 APN 9 53373965 missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53376569 missense probably damaging 0.99
IGL02122:Exph5 APN 9 53373674 missense probably benign 0.05
IGL02156:Exph5 APN 9 53375641 missense probably damaging 0.96
IGL02192:Exph5 APN 9 53376325 nonsense probably null
IGL02491:Exph5 APN 9 53375043 missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53374978 missense probably damaging 0.96
R0002:Exph5 UTSW 9 53373956 missense probably damaging 0.99
R0026:Exph5 UTSW 9 53376479 missense probably benign 0.38
R0086:Exph5 UTSW 9 53337930 missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53353204 critical splice donor site probably null
R0369:Exph5 UTSW 9 53373302 missense probably benign 0.35
R0409:Exph5 UTSW 9 53374343 missense probably benign 0.00
R0517:Exph5 UTSW 9 53372762 missense probably benign 0.02
R0658:Exph5 UTSW 9 53377475 missense unknown
R1606:Exph5 UTSW 9 53374295 missense probably benign 0.37
R1739:Exph5 UTSW 9 53375588 missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53373809 missense probably benign 0.35
R1828:Exph5 UTSW 9 53376641 missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53376248 missense probably benign
R1993:Exph5 UTSW 9 53373635 missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53367166 missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53372679 missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53374925 nonsense probably null
R3817:Exph5 UTSW 9 53375494 nonsense probably null
R4771:Exph5 UTSW 9 53373665 missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53376239 missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53376625 missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53375610 missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53337930 missense probably damaging 0.99
R5522:Exph5 UTSW 9 53374313 missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53375222 missense probably benign 0.04
R5961:Exph5 UTSW 9 53377255 missense probably damaging 1.00
R6093:Exph5 UTSW 9 53372617 missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53373028 missense probably benign 0.21
R6254:Exph5 UTSW 9 53372710 missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53376691 missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53301712 start gained probably benign
R6792:Exph5 UTSW 9 53375317 missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53340428 missense probably benign 0.27
R7340:Exph5 UTSW 9 53377009 missense probably damaging 0.99
R7347:Exph5 UTSW 9 53375896 missense possibly damaging 0.79
R7520:Exph5 UTSW 9 53367214 critical splice donor site probably null
R7521:Exph5 UTSW 9 53374077 missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53375773 missense probably benign 0.41
R7581:Exph5 UTSW 9 53372557 missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53373175 missense possibly damaging 0.62
X0028:Exph5 UTSW 9 53376263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGCAGGTTGACTCCGC -3'
(R):5'- CTGCACATGTCCCAGAATCTC -3'

Sequencing Primer
(F):5'- AGGTTGACTCCGCTCCATG -3'
(R):5'- TCATCATTATCTTCTGAGCGGG -3'
Posted On2019-09-13