Mutagenetix > Incidental Mutation

Incidental Mutation 'R7352:Vps13c'

570665

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

045438-MU

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7352 (G1)

Quality Score

173.646

Status

Not validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67840446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 7 (V7A)

Ref Sequence

ENSEMBL: ENSMUSP00000077040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077879
AA Change: V7A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: V7A

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217386
AA Change: V7A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA792892	A	T	5: 94,383,884	N209I	probably damaging	Het
Abca17	C	T	17: 24,289,054	W1124*	probably null	Het
Acap3	G	A	4: 155,905,711	V783I	possibly damaging	Het
Alkbh8	A	G	9: 3,345,796	K172R	probably damaging	Het
Ankrd28	A	G	14: 31,708,041	L860P	probably damaging	Het
Arap3	G	A	18: 37,973,278	T1504I	probably benign	Het
Atad5	T	C	11: 80,103,343		probably null	Het
Atp8a2	A	G	14: 59,791,204	V938A	probably benign	Het
AW551984	T	C	9: 39,592,925	M582V	probably benign	Het
Axdnd1	C	T	1: 156,382,477	V408I	possibly damaging	Het
Babam2	T	A	5: 32,007,250	Y326*	probably null	Het
Baiap2l1	T	C	5: 144,324,626	M20V	probably benign	Het
Bex6	A	G	16: 32,186,216		probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Cad	T	A	5: 31,058,078	S78T	probably damaging	Het
Ccdc171	T	A	4: 83,818,023	D1210E	possibly damaging	Het
Ccnd1	T	C	7: 144,937,387	I161V	possibly damaging	Het
Cdc42bpb	A	T	12: 111,299,311	F1396I	probably damaging	Het
Cep170	A	T	1: 176,769,857	D373E	probably benign	Het
Chrna4	A	T	2: 181,037,474	I60N	probably damaging	Het
Cntn2	T	C	1: 132,522,399	T586A	probably benign	Het
Csmd2	G	T	4: 128,557,636	V3396F		Het
Cyp3a44	T	A	5: 145,803,688	L47F	probably benign	Het
D7Ertd443e	A	T	7: 134,349,394	H183Q	probably benign	Het
Ddx27	T	C	2: 167,029,513	V510A	probably benign	Het
Ddx58	T	A	4: 40,239,668	Q10L	probably benign	Het
Dgat1	G	T	15: 76,502,824	C396*	probably null	Het
Dmpk	A	G	7: 19,086,072	S83G	probably damaging	Het
Dsc2	T	G	18: 20,035,335	D689A	probably benign	Het
Eppk1	A	T	15: 76,106,418	W2088R	probably benign	Het
Exph5	A	C	9: 53,375,722	I1368L	probably benign	Het
Fadd	T	C	7: 144,580,659	K163R	probably benign	Het
Fam149a	T	A	8: 45,340,997	Q759L	probably damaging	Het
Foxo6	A	T	4: 120,268,251	M449K	probably benign	Het
Gad1	T	C	2: 70,594,750	F463L	probably benign	Het
Gad2	T	A	2: 22,623,823	F91I	probably benign	Het
Gcc2	T	C	10: 58,280,698		probably null	Het
Gjc1	A	C	11: 102,800,452	C242G	probably damaging	Het
Gkn1	T	C	6: 87,348,118	E103G	possibly damaging	Het
Gm867	T	C	10: 75,939,836	T39A	probably benign	Het
Gpr108	A	G	17: 57,236,944	Y421H	probably damaging	Het
Gramd1b	A	C	9: 40,307,993	V508G	probably damaging	Het
Grm1	A	T	10: 10,719,493	I797N	probably damaging	Het
Ice1	G	A	13: 70,606,102	Q622*	probably null	Het
Kcnb2	T	A	1: 15,710,611	V569E	probably benign	Het
Ksr2	T	G	5: 117,689,641	I495S	probably benign	Het
Litaf	A	T	16: 10,963,353	M94K	probably damaging	Het
Lmod2	T	C	6: 24,598,111	S77P	possibly damaging	Het
Lrp2	G	T	2: 69,472,397	S2996Y	probably benign	Het
Ltf	T	C	9: 111,028,450	S436P	probably benign	Het
Map4k4	T	A	1: 39,962,227	V58D	unknown	Het
Mapkapk3	C	A	9: 107,257,070	D332Y	possibly damaging	Het
Mroh1	C	A	15: 76,451,474	P1439Q	probably benign	Het
Ncor1	A	G	11: 62,333,911	V841A	probably damaging	Het
Nrxn3	A	G	12: 88,850,293	M248V	probably benign	Het
Olfr1000	T	C	2: 85,608,784	N42S	probably damaging	Het
Olfr1208	T	A	2: 88,896,718	N293I	probably damaging	Het
Olfr1238	T	C	2: 89,406,462	M206V	probably benign	Het
Olfr1239	C	A	2: 89,417,967	G149W	probably damaging	Het
Olfr1443	A	G	19: 12,680,751	I214M	possibly damaging	Het
Olfr523	A	T	7: 140,176,525	Y135F	probably damaging	Het
Olig2	A	G	16: 91,226,689	D97G	probably benign	Het
Pcdha11	T	A	18: 37,006,845	V509E	probably damaging	Het
Pglyrp3	G	A	3: 92,014,640	W5*	probably null	Het
Phf14	A	T	6: 11,961,638	N425Y	probably damaging	Het
Phf3	G	T	1: 30,804,326	R1851S	possibly damaging	Het
Pigs	A	G	11: 78,328,812	T39A	probably damaging	Het
Plin4	A	G	17: 56,104,427	M868T	probably benign	Het
Pnma2	A	G	14: 66,916,421	Q98R	possibly damaging	Het
Ppp4r3a	G	A	12: 101,041,832	T782I	probably damaging	Het
Prickle2	T	G	6: 92,410,890	E566D	probably benign	Het
Pvr	A	G	7: 19,910,616	I331T	possibly damaging	Het
Ranbp3l	A	T	15: 8,968,358		probably benign	Het
Rapgef4	T	A	2: 72,180,091	I331N	probably damaging	Het
Reg3g	C	T	6: 78,466,859	W122*	probably null	Het
Rlbp1	A	T	7: 79,381,680	I100N	probably damaging	Het
Rnf213	T	A	11: 119,443,579	Y3206N		Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Rtl6	G	T	15: 84,556,980	R72S	possibly damaging	Het
Rufy3	T	A	5: 88,637,194	D408E	possibly damaging	Het
Scn3a	T	C	2: 65,525,701	I230V	possibly damaging	Het
Slc23a4	A	T	6: 34,948,279	I507N	possibly damaging	Het
Slc4a8	A	G	15: 100,790,984	T392A	probably damaging	Het
Spaca7	T	A	8: 12,585,742	I86K	probably benign	Het
Syt10	G	T	15: 89,814,456	D228E	probably benign	Het
Tbx3	T	A	5: 119,677,560	N308K	probably benign	Het
Telo2	A	G	17: 25,102,069	V724A	probably damaging	Het
Tfip11	T	C	5: 112,333,268	V370A	probably benign	Het
Thbs3	A	G	3: 89,225,280	E843G	probably benign	Het
Tmprss11g	T	C	5: 86,496,542	I148V	not run	Het
Trbv14	T	A	6: 41,135,495	D75E	possibly damaging	Het
Trio	A	G	15: 27,732,876	V2973A	probably damaging	Het
Ttn	T	C	2: 76,794,484	D15250G	probably damaging	Het
Ubr2	G	A	17: 46,930,426	T1734I	probably benign	Het
Ush2a	G	T	1: 188,466,124	A1462S	probably benign	Het
Ushbp1	T	G	8: 71,388,881	T435P	possibly damaging	Het
Wnk4	T	C	11: 101,264,418	V385A	probably damaging	Het
Wnt2b	C	T	3: 104,947,177	V322I	probably benign	Het
Zbtb8a	C	T	4: 129,360,081	V207M	probably benign	Het
Zc3hav1l	A	G	6: 38,298,981	M87T	probably benign	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
Derivative	UTSW	9	67930622	missense	possibly damaging	0.79
diversion	UTSW	9	67910233	missense	possibly damaging	0.93
introversion	UTSW	9	67944046	missense	probably damaging	0.98
Inversion	UTSW	9	67902839	critical splice acceptor site	probably null
subversion	UTSW	9	67908052	missense	probably damaging	1.00
Transversion	UTSW	9	67934501	missense	probably damaging	0.98
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0667:Vps13c	UTSW	9	67951573	nonsense	probably null
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1795:Vps13c	UTSW	9	67893985	nonsense	probably null
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1835:Vps13c	UTSW	9	67993013	missense	probably benign	0.08
R1848:Vps13c	UTSW	9	67936340	missense	probably benign
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1945:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5893:Vps13c	UTSW	9	67902839	critical splice acceptor site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7516:Vps13c	UTSW	9	67955007	missense	possibly damaging	0.89
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
R8734:Vps13c	UTSW	9	67973403	missense	probably damaging	1.00
R8806:Vps13c	UTSW	9	67945828	missense	probably damaging	1.00
R8807:Vps13c	UTSW	9	67858840	missense	probably damaging	0.99
R8813:Vps13c	UTSW	9	67871284	missense	probably damaging	1.00
R8883:Vps13c	UTSW	9	67948197	missense	probably benign	0.10
R8885:Vps13c	UTSW	9	67943454	missense	probably benign
R8899:Vps13c	UTSW	9	67934501	missense	probably damaging	0.98
R8970:Vps13c	UTSW	9	67945521	missense	probably benign	0.11
R9007:Vps13c	UTSW	9	67937724	missense	probably benign	0.00
R9026:Vps13c	UTSW	9	67954581	missense	probably damaging	1.00
R9029:Vps13c	UTSW	9	67948147	missense	probably damaging	0.98
R9057:Vps13c	UTSW	9	67920927	missense	probably benign	0.00
R9105:Vps13c	UTSW	9	67870799	intron	probably benign
R9130:Vps13c	UTSW	9	67929523	missense	probably damaging	1.00
R9286:Vps13c	UTSW	9	67972921	missense	probably benign	0.00
R9338:Vps13c	UTSW	9	67951695	missense	probably damaging	1.00
R9432:Vps13c	UTSW	9	67922855	missense	probably benign	0.02
R9460:Vps13c	UTSW	9	67930622	missense	possibly damaging	0.79
R9464:Vps13c	UTSW	9	67951392	missense	probably damaging	1.00
R9561:Vps13c	UTSW	9	67965512	missense	probably damaging	1.00
R9609:Vps13c	UTSW	9	67934549	missense	probably damaging	1.00
R9622:Vps13c	UTSW	9	67949433	missense	probably damaging	1.00
R9665:Vps13c	UTSW	9	67955743	nonsense	probably null
R9731:Vps13c	UTSW	9	67919244	missense	probably benign
R9763:Vps13c	UTSW	9	67911578	missense	probably benign	0.00
R9774:Vps13c	UTSW	9	67884591	missense	possibly damaging	0.85
R9798:Vps13c	UTSW	9	67919364	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAGGGTCTTACTATGTATCTTTGGT -3'
(R):5'- ACATCGACAGCAGGGGCA -3'

Sequencing Primer
(F):5'- TCGAACACAGCTTTGTGCAG -3'
(R):5'- AAGCCCAGCGAGGTCAC -3'

Posted On

2019-09-13