Mutagenetix > Incidental Mutations

Incidental Mutation 'R7352:Dsc2'

570701

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7352 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 20035335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 689 (D689A)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably benign
Transcript: ENSMUST00000039247
AA Change: D689A

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: D689A

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075214
AA Change: D689A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: D689A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155407
AA Change: D88A

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331
AA Change: D88A

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA792892	A	T	5: 94,383,884	N209I	probably damaging	Het
Abca17	C	T	17: 24,289,054	W1124*	probably null	Het
Acap3	G	A	4: 155,905,711	V783I	possibly damaging	Het
Alkbh8	A	G	9: 3,345,796	K172R	probably damaging	Het
Ankrd28	A	G	14: 31,708,041	L860P	probably damaging	Het
Arap3	G	A	18: 37,973,278	T1504I	probably benign	Het
Atad5	T	C	11: 80,103,343		probably null	Het
Atp8a2	A	G	14: 59,791,204	V938A	probably benign	Het
AW551984	T	C	9: 39,592,925	M582V	probably benign	Het
Axdnd1	C	T	1: 156,382,477	V408I	possibly damaging	Het
Babam2	T	A	5: 32,007,250	Y326*	probably null	Het
Baiap2l1	T	C	5: 144,324,626	M20V	probably benign	Het
Bex6	A	G	16: 32,186,216		probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Cad	T	A	5: 31,058,078	S78T	probably damaging	Het
Ccdc171	T	A	4: 83,818,023	D1210E	possibly damaging	Het
Ccnd1	T	C	7: 144,937,387	I161V	possibly damaging	Het
Cdc42bpb	A	T	12: 111,299,311	F1396I	probably damaging	Het
Cep170	A	T	1: 176,769,857	D373E	probably benign	Het
Chrna4	A	T	2: 181,037,474	I60N	probably damaging	Het
Cntn2	T	C	1: 132,522,399	T586A	probably benign	Het
Csmd2	G	T	4: 128,557,636	V3396F		Het
Cyp3a44	T	A	5: 145,803,688	L47F	probably benign	Het
D7Ertd443e	A	T	7: 134,349,394	H183Q	probably benign	Het
Ddx27	T	C	2: 167,029,513	V510A	probably benign	Het
Ddx58	T	A	4: 40,239,668	Q10L	probably benign	Het
Dgat1	G	T	15: 76,502,824	C396*	probably null	Het
Dmpk	A	G	7: 19,086,072	S83G	probably damaging	Het
Eppk1	A	T	15: 76,106,418	W2088R	probably benign	Het
Exph5	A	C	9: 53,375,722	I1368L	probably benign	Het
Fadd	T	C	7: 144,580,659	K163R	probably benign	Het
Fam149a	T	A	8: 45,340,997	Q759L	probably damaging	Het
Foxo6	A	T	4: 120,268,251	M449K	probably benign	Het
Gad1	T	C	2: 70,594,750	F463L	probably benign	Het
Gad2	T	A	2: 22,623,823	F91I	probably benign	Het
Gcc2	T	C	10: 58,280,698		probably null	Het
Gjc1	A	C	11: 102,800,452	C242G	probably damaging	Het
Gkn1	T	C	6: 87,348,118	E103G	possibly damaging	Het
Gm867	T	C	10: 75,939,836	T39A	probably benign	Het
Gpr108	A	G	17: 57,236,944	Y421H	probably damaging	Het
Gramd1b	A	C	9: 40,307,993	V508G	probably damaging	Het
Grm1	A	T	10: 10,719,493	I797N	probably damaging	Het
Ice1	G	A	13: 70,606,102	Q622*	probably null	Het
Kcnb2	T	A	1: 15,710,611	V569E	probably benign	Het
Ksr2	T	G	5: 117,689,641	I495S	probably benign	Het
Litaf	A	T	16: 10,963,353	M94K	probably damaging	Het
Lmod2	T	C	6: 24,598,111	S77P	possibly damaging	Het
Lrp2	G	T	2: 69,472,397	S2996Y	probably benign	Het
Ltf	T	C	9: 111,028,450	S436P	probably benign	Het
Map4k4	T	A	1: 39,962,227	V58D	unknown	Het
Mapkapk3	C	A	9: 107,257,070	D332Y	possibly damaging	Het
Mroh1	C	A	15: 76,451,474	P1439Q	probably benign	Het
Ncor1	A	G	11: 62,333,911	V841A	probably damaging	Het
Nrxn3	A	G	12: 88,850,293	M248V	probably benign	Het
Olfr1000	T	C	2: 85,608,784	N42S	probably damaging	Het
Olfr1208	T	A	2: 88,896,718	N293I	probably damaging	Het
Olfr1238	T	C	2: 89,406,462	M206V	probably benign	Het
Olfr1239	C	A	2: 89,417,967	G149W	probably damaging	Het
Olfr1443	A	G	19: 12,680,751	I214M	possibly damaging	Het
Olfr523	A	T	7: 140,176,525	Y135F	probably damaging	Het
Olig2	A	G	16: 91,226,689	D97G	probably benign	Het
Pcdha11	T	A	18: 37,006,845	V509E	probably damaging	Het
Pglyrp3	G	A	3: 92,014,640	W5*	probably null	Het
Phf14	A	T	6: 11,961,638	N425Y	probably damaging	Het
Phf3	G	T	1: 30,804,326	R1851S	possibly damaging	Het
Pigs	A	G	11: 78,328,812	T39A	probably damaging	Het
Plin4	A	G	17: 56,104,427	M868T	probably benign	Het
Pnma2	A	G	14: 66,916,421	Q98R	possibly damaging	Het
Ppp4r3a	G	A	12: 101,041,832	T782I	probably damaging	Het
Prickle2	T	G	6: 92,410,890	E566D	probably benign	Het
Pvr	A	G	7: 19,910,616	I331T	possibly damaging	Het
Ranbp3l	A	T	15: 8,968,358		probably benign	Het
Rapgef4	T	A	2: 72,180,091	I331N	probably damaging	Het
Reg3g	C	T	6: 78,466,859	W122*	probably null	Het
Rlbp1	A	T	7: 79,381,680	I100N	probably damaging	Het
Rnf213	T	A	11: 119,443,579	Y3206N		Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Rtl6	G	T	15: 84,556,980	R72S	possibly damaging	Het
Rufy3	T	A	5: 88,637,194	D408E	possibly damaging	Het
Scn3a	T	C	2: 65,525,701	I230V	possibly damaging	Het
Slc23a4	A	T	6: 34,948,279	I507N	possibly damaging	Het
Slc4a8	A	G	15: 100,790,984	T392A	probably damaging	Het
Spaca7	T	A	8: 12,585,742	I86K	probably benign	Het
Syt10	G	T	15: 89,814,456	D228E	probably benign	Het
Tbx3	T	A	5: 119,677,560	N308K	probably benign	Het
Telo2	A	G	17: 25,102,069	V724A	probably damaging	Het
Tfip11	T	C	5: 112,333,268	V370A	probably benign	Het
Thbs3	A	G	3: 89,225,280	E843G	probably benign	Het
Tmprss11g	T	C	5: 86,496,542	I148V	not run	Het
Trbv14	T	A	6: 41,135,495	D75E	possibly damaging	Het
Trio	A	G	15: 27,732,876	V2973A	probably damaging	Het
Ttn	T	C	2: 76,794,484	D15250G	probably damaging	Het
Ubr2	G	A	17: 46,930,426	T1734I	probably benign	Het
Ush2a	G	T	1: 188,466,124	A1462S	probably benign	Het
Ushbp1	T	G	8: 71,388,881	T435P	possibly damaging	Het
Vps13c	T	C	9: 67,840,446	V7A	possibly damaging	Het
Wnk4	T	C	11: 101,264,418	V385A	probably damaging	Het
Wnt2b	C	T	3: 104,947,177	V322I	probably benign	Het
Zbtb8a	C	T	4: 129,360,081	V207M	probably benign	Het
Zc3hav1l	A	G	6: 38,298,981	M87T	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATACTCTGCTGACAAGACAG -3'
(R):5'- GCTCGTCTTTCCTATCAGAACG -3'

Sequencing Primer
(F):5'- GTTCAGTAGATAAATGCGCTCGCC -3'
(R):5'- ATCAGAACGACCCTTCATTTGG -3'

Posted On

2019-09-13