Incidental Mutation 'R7352:Pcdha11'
ID 570702
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Name protocadherin alpha 11
Synonyms A830022B16Rik, Crnr7, Cnr7
MMRRC Submission 045438-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R7352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 37010712-37187657 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37006845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 509 (V509E)
Ref Sequence ENSEMBL: ENSMUSP00000111322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
AlphaFold Q91Y19
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115658
AA Change: V509E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440
AA Change: V509E

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 A T 5: 94,383,884 N209I probably damaging Het
Abca17 C T 17: 24,289,054 W1124* probably null Het
Acap3 G A 4: 155,905,711 V783I possibly damaging Het
Alkbh8 A G 9: 3,345,796 K172R probably damaging Het
Ankrd28 A G 14: 31,708,041 L860P probably damaging Het
Arap3 G A 18: 37,973,278 T1504I probably benign Het
Atad5 T C 11: 80,103,343 probably null Het
Atp8a2 A G 14: 59,791,204 V938A probably benign Het
AW551984 T C 9: 39,592,925 M582V probably benign Het
Axdnd1 C T 1: 156,382,477 V408I possibly damaging Het
Babam2 T A 5: 32,007,250 Y326* probably null Het
Baiap2l1 T C 5: 144,324,626 M20V probably benign Het
Bex6 A G 16: 32,186,216 probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Cad T A 5: 31,058,078 S78T probably damaging Het
Ccdc171 T A 4: 83,818,023 D1210E possibly damaging Het
Ccnd1 T C 7: 144,937,387 I161V possibly damaging Het
Cdc42bpb A T 12: 111,299,311 F1396I probably damaging Het
Cep170 A T 1: 176,769,857 D373E probably benign Het
Chrna4 A T 2: 181,037,474 I60N probably damaging Het
Cntn2 T C 1: 132,522,399 T586A probably benign Het
Csmd2 G T 4: 128,557,636 V3396F Het
Cyp3a44 T A 5: 145,803,688 L47F probably benign Het
D7Ertd443e A T 7: 134,349,394 H183Q probably benign Het
Ddx27 T C 2: 167,029,513 V510A probably benign Het
Ddx58 T A 4: 40,239,668 Q10L probably benign Het
Dgat1 G T 15: 76,502,824 C396* probably null Het
Dmpk A G 7: 19,086,072 S83G probably damaging Het
Dsc2 T G 18: 20,035,335 D689A probably benign Het
Eppk1 A T 15: 76,106,418 W2088R probably benign Het
Exph5 A C 9: 53,375,722 I1368L probably benign Het
Fadd T C 7: 144,580,659 K163R probably benign Het
Fam149a T A 8: 45,340,997 Q759L probably damaging Het
Foxo6 A T 4: 120,268,251 M449K probably benign Het
Gad1 T C 2: 70,594,750 F463L probably benign Het
Gad2 T A 2: 22,623,823 F91I probably benign Het
Gcc2 T C 10: 58,280,698 probably null Het
Gjc1 A C 11: 102,800,452 C242G probably damaging Het
Gkn1 T C 6: 87,348,118 E103G possibly damaging Het
Gm867 T C 10: 75,939,836 T39A probably benign Het
Gpr108 A G 17: 57,236,944 Y421H probably damaging Het
Gramd1b A C 9: 40,307,993 V508G probably damaging Het
Grm1 A T 10: 10,719,493 I797N probably damaging Het
Ice1 G A 13: 70,606,102 Q622* probably null Het
Kcnb2 T A 1: 15,710,611 V569E probably benign Het
Ksr2 T G 5: 117,689,641 I495S probably benign Het
Litaf A T 16: 10,963,353 M94K probably damaging Het
Lmod2 T C 6: 24,598,111 S77P possibly damaging Het
Lrp2 G T 2: 69,472,397 S2996Y probably benign Het
Ltf T C 9: 111,028,450 S436P probably benign Het
Map4k4 T A 1: 39,962,227 V58D unknown Het
Mapkapk3 C A 9: 107,257,070 D332Y possibly damaging Het
Mroh1 C A 15: 76,451,474 P1439Q probably benign Het
Ncor1 A G 11: 62,333,911 V841A probably damaging Het
Nrxn3 A G 12: 88,850,293 M248V probably benign Het
Olfr1000 T C 2: 85,608,784 N42S probably damaging Het
Olfr1208 T A 2: 88,896,718 N293I probably damaging Het
Olfr1238 T C 2: 89,406,462 M206V probably benign Het
Olfr1239 C A 2: 89,417,967 G149W probably damaging Het
Olfr1443 A G 19: 12,680,751 I214M possibly damaging Het
Olfr523 A T 7: 140,176,525 Y135F probably damaging Het
Olig2 A G 16: 91,226,689 D97G probably benign Het
Pglyrp3 G A 3: 92,014,640 W5* probably null Het
Phf14 A T 6: 11,961,638 N425Y probably damaging Het
Phf3 G T 1: 30,804,326 R1851S possibly damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Pnma2 A G 14: 66,916,421 Q98R possibly damaging Het
Ppp4r3a G A 12: 101,041,832 T782I probably damaging Het
Prickle2 T G 6: 92,410,890 E566D probably benign Het
Pvr A G 7: 19,910,616 I331T possibly damaging Het
Ranbp3l A T 15: 8,968,358 probably benign Het
Rapgef4 T A 2: 72,180,091 I331N probably damaging Het
Reg3g C T 6: 78,466,859 W122* probably null Het
Rlbp1 A T 7: 79,381,680 I100N probably damaging Het
Rnf213 T A 11: 119,443,579 Y3206N Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Rtl6 G T 15: 84,556,980 R72S possibly damaging Het
Rufy3 T A 5: 88,637,194 D408E possibly damaging Het
Scn3a T C 2: 65,525,701 I230V possibly damaging Het
Slc23a4 A T 6: 34,948,279 I507N possibly damaging Het
Slc4a8 A G 15: 100,790,984 T392A probably damaging Het
Spaca7 T A 8: 12,585,742 I86K probably benign Het
Syt10 G T 15: 89,814,456 D228E probably benign Het
Tbx3 T A 5: 119,677,560 N308K probably benign Het
Telo2 A G 17: 25,102,069 V724A probably damaging Het
Tfip11 T C 5: 112,333,268 V370A probably benign Het
Thbs3 A G 3: 89,225,280 E843G probably benign Het
Tmprss11g T C 5: 86,496,542 I148V not run Het
Trbv14 T A 6: 41,135,495 D75E possibly damaging Het
Trio A G 15: 27,732,876 V2973A probably damaging Het
Ttn T C 2: 76,794,484 D15250G probably damaging Het
Ubr2 G A 17: 46,930,426 T1734I probably benign Het
Ush2a G T 1: 188,466,124 A1462S probably benign Het
Ushbp1 T G 8: 71,388,881 T435P possibly damaging Het
Vps13c T C 9: 67,840,446 V7A possibly damaging Het
Wnk4 T C 11: 101,264,418 V385A probably damaging Het
Wnt2b C T 3: 104,947,177 V322I probably benign Het
Zbtb8a C T 4: 129,360,081 V207M probably benign Het
Zc3hav1l A G 6: 38,298,981 M87T probably benign Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37007373 missense probably benign 0.13
R4489:Pcdha11 UTSW 18 37006916 missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37012169 splice site probably null
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37011368 nonsense probably null
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7319:Pcdha11 UTSW 18 37013192 missense probably benign 0.10
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
R7660:Pcdha11 UTSW 18 37005851 missense probably benign 0.17
R7677:Pcdha11 UTSW 18 37011552 missense probably damaging 1.00
R7707:Pcdha11 UTSW 18 37011792 missense probably benign 0.00
R7775:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7778:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7780:Pcdha11 UTSW 18 37012796 missense probably damaging 0.97
R7916:Pcdha11 UTSW 18 37007388 missense probably benign 0.01
R7991:Pcdha11 UTSW 18 37012856 missense probably damaging 0.99
R8068:Pcdha11 UTSW 18 37005565 missense probably damaging 1.00
R8220:Pcdha11 UTSW 18 37006571 missense probably benign 0.01
R8252:Pcdha11 UTSW 18 37007537 missense possibly damaging 0.65
R8392:Pcdha11 UTSW 18 37006159 nonsense probably null
R8398:Pcdha11 UTSW 18 37013063 missense possibly damaging 0.65
R8470:Pcdha11 UTSW 18 37012884 missense probably benign 0.07
R8812:Pcdha11 UTSW 18 37007663 missense probably benign 0.00
R8900:Pcdha11 UTSW 18 37012746 missense probably damaging 1.00
R8968:Pcdha11 UTSW 18 37012254 missense probably damaging 1.00
R9065:Pcdha11 UTSW 18 37006824 missense possibly damaging 0.93
R9192:Pcdha11 UTSW 18 37007474 missense probably benign 0.42
R9224:Pcdha11 UTSW 18 37006020 missense probably damaging 0.99
R9228:Pcdha11 UTSW 18 37011459 missense probably damaging 1.00
R9237:Pcdha11 UTSW 18 37012207 missense probably damaging 1.00
R9336:Pcdha11 UTSW 18 37011461 missense probably damaging 1.00
R9449:Pcdha11 UTSW 18 37012431 missense probably damaging 1.00
R9475:Pcdha11 UTSW 18 37007538 missense probably damaging 1.00
R9476:Pcdha11 UTSW 18 37006479 missense probably benign 0.26
R9510:Pcdha11 UTSW 18 37006479 missense probably benign 0.26
R9578:Pcdha11 UTSW 18 37007123 missense probably damaging 1.00
R9654:Pcdha11 UTSW 18 37012280 missense probably damaging 1.00
RF017:Pcdha11 UTSW 18 37005524 missense possibly damaging 0.92
Z1177:Pcdha11 UTSW 18 37012923 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GTGAACGACAATGCTCCTGC -3'
(R):5'- AGGCACAAGCTCACTCACTG -3'

Sequencing Primer
(F):5'- TGCATTCGCACAGTCGGAATAC -3'
(R):5'- AGCTCACTCACTGCCCCG -3'
Posted On 2019-09-13